Inibizione allosterica del fattore 2 inducibile dall'ipossia con piccole molecole | biologia chimica naturale

Inibizione allosterica del fattore 2 inducibile dall'ipossia con piccole molecole | biologia chimica naturale

Anonim

Soggetti

  • Biochimica
  • Biofisica
  • Cancro
  • Strumenti chimici
  • Screening ad alto rendimento
  • Piccole molecole

Astratto

I fattori inducibili dell'ipossia (HIF) sono fattori di trascrizione eterodimerica indotti in molti tumori dove promuovono frequentemente l'espressione di vie protumorigeniche. Sebbene i fattori di trascrizione siano tipicamente considerati "indistruttibili", il dominio PAS-B della subunità HIF-2α contiene una grande cavità all'interno del suo nucleo idrofobo che offre un punto d'appoggio unico per la regolazione di piccole molecole. Qui identifichiamo i ligandi artificiali che si legano all'interno di questa tasca e caratterizzano i conseguenti cambiamenti strutturali e funzionali causati dal legame. In particolare, questi ligandi antagonizzano l'eterodimerizzazione HIF-2 e l'attività legante il DNA in vitro e nelle cellule in coltura, riducendo l'espressione genica bersaglio dell'HIF-2. Nonostante l'elevata identità di sequenza tra HIF-2α e HIF-1α, questi ligandi sono altamente selettivi e non influenzano la funzione HIF-1. Questi strumenti chimici stabiliscono le basi molecolari per la regolazione selettiva di HIF-2, fornendo potenziali opportunità terapeutiche per intervenire nei tumori guidati da HIF-2, come i carcinomi a cellule renali.

  • Composto C 12 H 6 ClN 5 O 5

    N - (4-cloro-3-nitrofenil) -4-nitrobenzo [ c ] [1, 2, 5] ossadiazol-5-ammina

  • Composto C 12 H 6 ClFN 4 O 3

    N - (3-cloro-5-fluorofenil) -4-nitrobenzo [ c ] [1, 2, 5] ossadiazol-5-ammina

Principale

Le cellule umane rispondono all'ipossia attraverso le azioni coordinate della famiglia HIF dei fattori di trascrizione 1 . Assemblate come eterodimeri di una subunità sensibile all'ossigeno (HIF-1α, HIF-2α o HIF-3α) e un partner di dimerizzazione (traslocatore nucleare di recettori aril idrocarburi (ARNT) o HIF-β), queste proteine ​​controllano l'espressione di centinaia di geni che facilita l'adattamento cellulare e le risposte a bassi livelli di ossigeno 2, 3 . Sebbene gli HIF svolgano funzioni fisiologiche critiche 1, 4, 5, quantità aumentate di questi potenti fattori sono altamente correlate con l'insorgenza e la progressione di una varietà di tumori 1 . In effetti, diversi obiettivi a valle dell'HIF sono obiettivi ben validati per le terapie antitumorali. Tuttavia, ci sono potenzialmente notevoli vantaggi nell'antagonizzare direttamente i complessi HIF stessi e, di conseguenza, i loro numerosi obiettivi a valle, come supportato da esperimenti che collegano l'ablazione HIF a una tumorigenesi compromessa 6, 7, 8 . Come tale, c'è un forte interesse nello sviluppo di composti artificiali per regolare la funzione HIF, per generare sia reagenti di ricerca di base che composti di piombo per lo sviluppo terapeutico.

Tuttavia, l'HIF presenta un obiettivo tradizionalmente stimolante per l'intervento farmacologico: è un grande complesso proteico intracellulare senza siti attivi, che sono tipicamente utilizzati per il legame di substrato di piccole molecole. Inoltre, gran parte del fattore di trascrizione risiede principalmente in una conformazione estesa, riducendo ulteriormente la disponibilità di potenziali siti di legame del ligando. Tuttavia, entrambe le subunità HIF contengono domini di interazione proteina-proteina Per-ARNT-Sim (PAS) che contribuiscono all'assemblaggio del complesso HIF 9, 10 e al reclutamento di coattivatori 11, 12 . Questi domini PAS sono ampiamente utilizzati come sensori ambientali in tutta la biologia, controllando le attività di una vasta gamma di proteine 13 . In particolare, tale rilevamento ambientale viene spesso ottenuto legando cofattori a piccole molecole all'interno del nucleo di un dominio PAS, usando le modifiche allosteriche indotte da ligando per controllare l'affinità per altri elementi proteici legati alla superficie esterna 14 . Date le difficoltà nell'antagonizzare direttamente e selettivamente le interazioni proteina-proteina con piccole molecole 15, 16, lo sfruttamento di tali cavità interne offre potenziali vantaggi.

Il dominio PAS-B di HIF-2α sembra essere particolarmente suscettibile alla regolazione allosterica mediata dal ligando. Questo particolare dominio PAS contiene una cavità preformata relativamente grande (290 Å 3 ) che può essere occupata dall'acqua o da piccole molecole 17, 18 . Usando schermi basati su NMR di librerie di piccoli frammenti, abbiamo precedentemente dimostrato che questo sito può essere legato da ligandi di piccole molecole con affinità submicromolari, inducendo cambiamenti conformazionali che compromettono l'eterodimerizzazione di domini PAS-B isolati in vitro 18 . Sfortunatamente, queste molecole non erano esse stesse adatte per un'ulteriore caratterizzazione delle cellule in coltura, portandoci a utilizzare uno schermo ad alto rendimento basato sulla funzione per esaminare una libreria più ampia di composti più complessi per inibitori in grado di interrompere un eterodimero HIF-2 PAS-B ingegnerizzato .

Qui avanziamo sostanzialmente questi studi attraverso lo sviluppo di un ponteggio a piccole molecole migliorato inizialmente identificato in questo schermo. La caratterizzazione biofisica di questi composti e un derivato ottimizzato dagli approcci di chimica medicinale dimostrano un legame specifico, selettivo ed efficace all'interno della cavità interna di HIF-2α PAS-B. Questi composti interrompono l'eterodimerizzazione del fattore di trascrizione HIF-2 a lunghezza intera. In particolare, queste molecole funzionano efficacemente come inibitori dell'HIF-2 nelle cellule viventi, interrompendo il legame con il DNA dell'HIF-2 e la trascrizione dei suoi geni bersaglio. Inoltre, questi composti sono selettivi per l'isoforma HIF-2 e non riescono ad antagonizzare l'HIF-1, la cui subunità HIF-1α altamente correlata manca di un sito di legame di ligando comparabile. Questi reagenti offrono l'opportunità di delineare le differenze nella fisiologia HIF-1 e HIF-2 e fungono da punto di ingresso per l'eventuale inattivazione terapeutica selettiva dell'HIF-2 nelle malattie 19, inclusi i carcinomi a cellule renali 20, 21, 22 .

risultati

Identificazione di antagonisti della dimerizzazione HIF-2 PAS-B

Abbiamo precedentemente identificato ligandi che legano il dominio HIF-2α PAS-B utilizzando lo screening basato sulla soluzione NMR di una piccola libreria di quasi 800 frammenti simili a farmaci 17, 18, 23 . Dopo l'ottimizzazione della chimica medicinale, alcuni composti di piombo avanzati legavano HIF-2α con costanti di dissociazione submicromolari. Nonostante le loro grandi dimensioni (peso molecolare ∼ 300 Da), tutti questi ligandi legati in una tasca interna (290 Å 3 ) completamente sepolti nel dominio HIF-2α PAS-B 17, 18 . Le cavità di queste dimensioni o più grandi sono piuttosto rare e sono presenti solo nello ∼ 0, 3% di oltre 32.000 strutture ad alta risoluzione di proteine ​​o domini proteici di dimensioni comparabili (Risultati supplementari, Figura 1 complementare). Quasi tutte queste cavità costituiscono siti leganti il ​​ligando all'interno delle apo forme di proteine ​​leganti il ​​ligando naturale. Coerentemente con un ruolo funzionale comparabile per la cavità in HIF-2α PAS-B, i nostri ligandi artificiali hanno mostrato capacità modeste di interrompere le interazioni isolate PAS-PAS in vitro 18 . Tuttavia, la loro limitata potenza nel fare così limitata ulteriore caratterizzazione nelle cellule viventi.

Per identificare impalcature chimiche superiori con il potenziale di antagonizzare l'attività HIF-2 nelle cellule viventi, abbiamo sviluppato un test in vitro che ha valutato l'interruzione funzionale delle interazioni PAS-PAS in un formato di screening ad alto rendimento (HTS). I domini isolati di tipo selvatico si associano a K D ∼ 100 μM, precludendo molti saggi di interazione proteina-proteina. Questa interazione può essere migliorata di oltre 100 volte introducendo mutazioni che migliorano le interazioni ioniche all'interfaccia complessa senza alterare altre caratteristiche PAS, incluso il sito di legame del ligando HIF-2α 18 . Queste varianti 'PAS-B *' (HIF-2α R247E e ARNT E362R ) sono state utilizzate in un saggio omogeneo di prossimità luminescente amplificato (AlphaScreen) per identificare composti in grado di interrompere l'eterodimero stabilizzato (Figura 2 complementare).

Usando questo test HTS, oltre 200.000 composti sono stati interrogati individualmente per la loro capacità di distruggere il complesso HIF-2α – ARNT PAS-B * (Tabella Supplementare 1). I primi 640 composti 'hit', ciascuno dei quali ha diminuito il segnale di prossimità della luminescenza di oltre 3 σ, sono stati rivalutati. Circa l'80% di questi hit iniziali sono stati convalidati, riflettendo l'alta qualità di questo schermo. Tuttavia, un numero elevato di questi successi confermati ha antagonizzato uno schermo di contrasto chiave progettato per eliminare i composti che interferiscono con il formato AlphaScreen stesso. Una volta eliminati questi composti non specifici, sono rimasti meno di 70 candidati interferenti dell'eterodimero HIF-2α – ARNT PAS-B *. Le successive titolazioni di un sottoinsieme fornito di questi composti hanno rivelato diversi composti con un comportamento dose-dipendente standard, con valori di concentrazione effettiva semi-massima (IC 50 ) compresi tra 0, 3 μM e 10 μM, come esemplificato per il composto 1 (Figura 3a, b supplementare ). In particolare, questa classe di composti ha condiviso alcune caratteristiche strutturali con composti legati all'ammina identificati dai nostri schermi di legame con leganti basati su NMR 17, 18, portandoci a studiare ulteriormente il loro modo di agire e la potenza.

In linea di principio, l'eterodimero HIF-2α – ARNT PAS-B * potrebbe essere interrotto da piccole molecole che si legano a una delle due subunità PAS-B, all'interno dei loro nuclei o sulle superfici del foglio β che mediano le interazioni proteina-proteina. Sulla base della somiglianza di 1 con i composti precedentemente osservati nei complessi HIF-2α – ligando 18, 23, abbiamo anticipato che potrebbero legarsi direttamente all'interno del dominio HIF-2α PAS-B *. Utilizzando la spettroscopia NMR per confrontare 15 spettri HSQC N- 1 H di entrambi i domini PAS-B in assenza e presenza di 1, sono stati osservati cambiamenti spettrali indotti da ligando per HIF-2α PAS-B ma non per il corrispondente ARNT PAS-B subunità (Figura 3c supplementare). Il comportamento di scambio lento per questi cambiamenti di spostamento chimico era coerente con costanti di dissociazione micro-microscopiche o più strette. Queste affinità di legame sono state quantificate usando la calorimetria di titolazione isotermica (ITC), riportando K D = 1, 1 μM e una stechiometria 1: 1 (Figura 3D aggiuntiva), sebbene l'elevato DMSO richiesto per solubilizzare 1 molto probabilmente attenuasse leggermente l'affinità del ligando vero 17 . Complessivamente, si è osservata una correlazione ragionevole tra l'affinità dei ligandi e l'IC 50 submicromolare (observed 0, 4 μM) osservata per l'interruzione dell'eterodimero (Figura 3b supplementare).

È stato intrapreso uno sforzo di chimica medicinale per comprendere le relazioni struttura-attività alla base della capacità di 1 di interrompere l'eterodimerizzazione HIF-2α – ARNT PAS-B * 24 . Un analogo migliorato, 2, è stato identificato (Fig. 1a) che ha anche legato il dominio HIF-2α PAS-B (Fig. 1b – d) con un K D di 81 nM (Fig. 1d). Nel loro insieme, questi dati indicano che questa classe di composti funziona legando direttamente HIF-2α.

Image

( a ) La struttura cristallina del complesso ternario di HIF-2 PAS-B * con 2 rivela il legame del ligando nella cavità interna sequestrata dal solvente sfuso all'interno del dominio HIF-2α PAS-B (grigio). Per chiarezza, la porzione ARNT – PAS-B * dell'eterodimero proteico non viene mostrata e una porzione della superficie HIF-2α PAS-B * (blu) è stata tagliata via per rivelare il sito di legame interno. ( b ) Contatti proteina-ligando come rivelato da una vista espansa del sito di legame di 2, dimostrando che è composto da una miscela di residui polari e idrofobici. ( c ) 15 N- 1 H spettri HSQC di 200 μM [ 15 N] HIF-2α PAS-B (pannello principale) e [ 15 N] ARNT PAS-B (inserto) in presenza di 0 μM, 125 μM e 250 μM 2 (da rosso a blu) dimostra il legame specifico di 2 con HIF-2α PAS-B. Tracce monodimensionali di spettri (nelle posizioni mostrate da linee tratteggiate) mostrano un comportamento di legame a scambio lento da 2 a HIF-2α e nessun legame con ARNT PAS-B. ( d ) misurazioni ITC da 2 a HIF-2α PAS-B quantificano l'affinità di legame e la stechiometria 1: 1.

Immagine a dimensione intera

Gli antagonisti si legano all'interno della cavità interna HIF-2α PAS-B

Per definire ulteriormente il modo in cui questi composti interrompono l'eterodimerizzazione HIF-2α – ARNT PAS-B *, abbiamo integrato gli studi NMR su cristallografia a raggi X e la soluzione ad alta risoluzione di HIF-2α PAS-B legati a 2. Come anticipato, una struttura di co-cristallo rivelato che questo ligando legato all'interno della cavità interna preformata HIF-2α PAS-B (Fig. 1a, b, Fig. 4 supplementare e Tabella 2 supplementare), spostando l'acqua. Il composto 2 condivide alcune caratteristiche strutturali comuni con i ligandi di piccole molecole precedentemente descritti (Figura 5 aggiuntiva), facilitando il legame con una combinazione di van der Waals e interazioni elettrostatiche, incluso (i) il posizionamento del gruppo ligando nitro e l'ammina linker adiacente alla catena laterale imidazolo His248, (ii) un legame π-idrogeno tra l'idrossile Tyr281 e l'anello benzenico A-ring e (iii) un legame idrogeno intraligando condiviso tra il legante amminico e la porzione nitro-A-ring. Un ulteriore esame della struttura suggerisce che 2 deriva la sua maggiore affinità da van der Waals potenziato e interazioni elettrostatiche. In particolare, il più grande anello di 2 alogenato di 2 completa meglio la tasca idrofobica circostante, che era solo parzialmente occupata dagli anelli B dei composti derivati ​​da frammenti THS-017, THS-020 e THS-044 che si legavano con costanti di dissociazione che vanno da Da 600 nM a 2 μM e entalpie molari inferiori 17, 18 ( fig.5 supplementare). Inoltre, l'anello A di 2 presenta potenziali nuove interazioni elettrostatiche, in particolare nel posizionamento dell'anello ossadiazolo legato all'idrogeno adiacente a una delle conformazioni della catena laterale Ser292 osservate nel complesso 2 ternario. Allo stesso modo, l'identificazione delle sostituzioni dell'anello B che integravano meglio la forma del sito di legame con le apo proteine ​​rispetto a quelle presenti in 1 era la chiave per lo sviluppo di 2 (Figura 5 aggiuntiva).

I ligandi associati inducono cambiamenti conformazionali HIF-2α PAS-B

Per ottenere intuizioni meccanicistiche sul legame tra legame di piccola molecola e interazioni proteina-proteina in HIF-2α PAS-B, abbiamo confrontato i dati cristallografici e di soluzione indipendenti acquisiti da apo e HIF-2α a 2 legami. Il complesso HIF-2α PAS-B – 2 era suscettibile di studi NMR in soluzione ad alta risoluzione (Fig. 1c), permettendoci di assegnare turni chimici alla spina dorsale e confrontarli con le informazioni esistenti sulle proteine ​​apoc 9 . Le differenze di spostamento chimico osservate tra questi insiemi (Fig. 2a) hanno stabilito che 2 legami hanno interessato molti siti della proteina circostante, che conserva ancora la piega del dominio PAS α-β misto. Mappando questi cambiamenti di spostamento sulla struttura cristallina (Fig. 2a, b), abbiamo osservato molte delle maggiori differenze sul foglio β (in particolare i filamenti Hβ, Iβ e Aβ). Le analisi cristallografiche parallele hanno utilizzato una differenza di analisi di Fourier di apo e HIF-2α-ARNT a 2 legami. I set di dati PAS-B * (con parametri cristallini molto simili) hanno mostrato cambiamenti associati ai ligandi nella densità degli elettroni sia all'interno della cavità HIF-2α sia attraverso il foglio β adiacente (Fig. 2c). In particolare, quasi nessuna densità di differenza F o - F o è stata osservata altrove nella struttura, inclusa la subunità ARNT PAS-B, fornendo un potente controllo per i manufatti dall'analisi. Queste analisi indipendenti collegano il ligando che si lega ai cambiamenti conformazionali sulla superficie del foglio β del dominio HIF-2α PAS-B, che viene utilizzato per legare la sua controparte ARNT (Figura 6 aggiuntiva), sostenendo fortemente una modalità di azione allosterica per il nostro artificiale inibitori.

Image

( a ) Le differenze di spostamento chimico della spina dorsale 1 H e 15 N tra gli stati apo e 2-bound sono mappate sulle strutture primarie e secondarie HIF-2α PAS-B. ( b ) Le perturbazioni dello spostamento chimico indotte dal ligando sono mappate sull'HIF-2α Struttura PAS-B con sfere che indicano i siti HIF-2α C α entro 8 Å dall'ARNT PAS-B. La vista è ruotata di circa 180 ° attorno all'asse y (verticale) dalla vista in Figura 1a. La scala dei colori da giallo a rosso mostrata a destra di a è anche usata in b e nella Figura 6. supplementare ( c ) I cambiamenti conformazionali indotti dal ligando in regioni simili sono evidenti anche dai dati di diffrazione dei raggi X, come rivelato da una F o (ligando) - F o (apo) mappa della differenza di densità elettronica (resa a 4 σ; densità positiva in verde, densità negativa in rosso).

Immagine a dimensione intera

Il ligando 2 interrompe selettivamente l'eterodimerizzazione HIF-2

Come 1, le modifiche conformazionali indotte da 2 interrompono l'eterodimerizzazione di domini HIF-2α e ARNT PAS-B * isolati nel test AlphaScreen (Fig. 3a). Tuttavia, l'eterodimerizzazione delle due subunità HIF a lunghezza intera è mediata da interazioni multiple proteina-proteina che coinvolgono i domini PAS-A e elica-ciclo-elica 10 . Per determinare se 2 può antagonizzare l'eterodimerizzazione tra polipeptidi HIF-2α e ARNT a lunghezza intera, abbiamo preparato estratti nucleari da cellule Hep3B ipossiche. Un anticorpo che riconosce l'N-terminale di ARNT 10 è stato usato per immunoprecipitare la proteina ARNT endogena dagli estratti nucleari (Fig. 3b e Fig. 7 supplementare). La subunità HIF-2α coimmunoprecipitata con ARNT in estratti incubati con il controllo del veicolo DMSO. Tuttavia, l'aggiunta di 2 agli estratti ha ridotto l'efficienza della coimmunoprecipitazione di HIF-2α di oltre un fattore due in modo dose-dipendente (Fig. 3b). L'entità di questi effetti sull'eterodimerizzazione HIF-2 è simile a quella osservata in seguito alla mutazione dell'interfaccia di dimerizzazione HIF-2α PAS-B 10 .

Image

( a ) Aggiunta di un gruppo eterodimero a 2 blocchi tra eterodimero ricombinante purificato HIF-2α PAS-B * e ARNT PAS-B * (quadrati) come valutato nel dosaggio AlphaScreen. Non è stato osservato alcun effetto nelle reazioni di controllo usando una singola proteina GST-ARNT – PAS-B * -Flag (doppiamente etichettata) in grado di assumere entrambe le sfere per indurre un segnale AlphaScreen (cerchi). I saggi sono stati eseguiti in triplice copia e le barre di errore rappresentano ± sd RU, unità relative. ( b ) Il composto 2 interrompe l'eterodimerizzazione del fattore di trascrizione HIF-2 a lunghezza intera. Gli estratti nucleari preparati da cellule Hep3B ipossiche che esprimono ARNT, HIF-2α e HIF-1α (input) sono stati incubati con concentrazioni crescenti di 2. L'analisi dell'immunoblot indica la quantità di polipeptidi HIF immunoprecipitati in assenza (–Ab) o la presenza di un anticorpo verso ARNT .

Immagine a dimensione intera

Oltre a HIF-2α, anche le cellule Hep3B esprimono HIF-1α. Sebbene queste due isoforme HIF-α condividano un'identità> 70% tra i loro domini PAS-B, la modellizzazione del dominio PAS-B HIF-1α sulla struttura PAS-B HIF-2α suggerisce che diversi residui più voluminosi si affacciano sull'HIF-1α interno cavità (Fig. 4a, be Fig. 8 supplementare). Si prevede che tali alterazioni restringano la tasca e interferiscano con il legame del ligando, e ciò è stato confermato dai dati ITC che dimostrano che 2 non lega efficacemente il dominio HIF-1α PAS-B (Fig. 4c; K D >> 5 μM). La grande selettività di 2 per HIF-2α è mostrata nella Figura 3b, poiché quantità crescenti di 2 hanno scarso effetto sull'eterodimerizzazione HIF-1 a tutta lunghezza, valutata mediante coimmunoprecipitazione. Questi dati confermano che, in vitro , 2 si lega selettivamente all'interno di un sito di legame ligando preformato sepolto all'interno del dominio HIF-2α PAS-B. Le conseguenti modifiche conformazionali allosteriche si propagano alla superficie del dominio, indebolendo le interazioni con il dominio ARNT PAS-B e interrompendo l'eterodimerizzazione del fattore di trascrizione HIF-2 a lunghezza intera.

Image

( a ) Confronto delle dimensioni della cavità interna (blu) identificate da una sonda 1.4-Å all'interno della nostra struttura cristallina HIF-2α PAS-B (codice PDB 3F1P) 18 (in alto) e un modello di omologia basato sul dominio HIF-1α PAS-B su questa struttura. Le differenze di sequenza tra questi due paraloghi strettamente correlati riducono la dimensione prevista della cavità HIF-1α PAS-B. ( b ) Il modello HIF-1α PAS-B suggerisce che diverse differenze di sequenza tra questi paraloghi portano al posizionamento di catene laterali più larghe (rosse) all'interno del nucleo HIF-1α PAS-B. Queste sostituzioni sembrano ridurre la cavità osservata in HIF-2α PAS-B (cavità HIF-2α PAS-B resa come una superficie blu, sovrapposta al modello HIF-1α PAS-B). Le differenze di aminoacidi sono indicate con la prima lettera che indica l'identità dell'amminoacido HIF-2 e l'ultima lettera che indica l'identità HIF-1. ( c ) Le misurazioni ITC di una titolazione HIF-1α PAS-B – 2 non mostrano l'interazione rilevabile proteina-ligando nelle stesse condizioni utilizzate per osservare il legame con HIF-2α PAS-B (Fig. 1d).

Immagine a dimensione intera

Il ligando 2 interrompe selettivamente l'HIF-2 nelle cellule in coltura

La migliore efficacia in vitro di 2 offre l'opportunità di validare l'antagonismo selettivo HIF-2 nelle cellule viventi. Non è stata osservata alcuna tossicità manifesta per 786-0 o cellule Hep3B incubate con fino a 30 μM di 2 (Figura 9 aggiuntiva). Il composto 2 non è stato prontamente metabolizzato come mostrato da un'emivita di ∼ 14 h ( t 1/2 ) quando incubato con 786-0 cellule in vitro ; esperimenti paralleli usando solo terreno di coltura non hanno mostrato perdite per 24 ore (dati non mostrati). Le 786-0 cellule derivate da un carcinoma a cellule renali umane mancano di una pVHL funzionale, l'ubiquitina ligasi E3 responsabile della marcatura dell'HIF-α per la degradazione proteasomale in condizioni normossiche. Queste cellule mancano anche dell'espressione HIF-1α rilevabile in modo che la regolazione HIF-dipendente dei geni bersaglio sia attribuibile all'isoforma HIF-2 che si accumula in modo costitutivo 25 . L'aggiunta di 2 a 786-0 cellule in coltura non altera l'espressione di HIF-2α né a livello di mRNA (Fig. 5a) né di proteina (Fig. 10 supplementare). Tuttavia, l'espressione di un gene target HIF-2 ben validato ( VEGFA ) è ridotta in modo dose-dipendente in 786-0 cellule incubate con 2 per 18 ore (Fig. 5a).

Image

( a, b ) Sebbene l'incubazione di 2 con cellule normossiche 786-0 non abbia alcun effetto sull'espressione HIF-2α (a), RT-PCR rivela che 2 antagonizza l'espressione dei geni target HIF-2 VEGFA in 786-0 cellule (a ) ed EPO nelle celle Hep3B (b, sinistra). Al contrario, la trascrizione di un gene bersaglio selettivo HIF-1 ( PGK1 ) nelle cellule Hep3B non è influenzata da 2 ( b, a destra). ( c ) Il composto 2 interrompe selettivamente il legame del DNA con HIF-2, ma non con HIF-1, in un test ChIP. I dati RT-PCR per ciascun gene sono la media di tre valori determinati da tre set raccolti in modo indipendente e le barre di errore rappresentano ± sd Le differenze tra i valori accoppiati sono statisticamente significative come determinato dal test t di Student. * P <0, 01; ** P <0, 001; NS, non significativo.

Immagine a dimensione intera

Per confermare che il modo di agire per l'inibizione di HIF-2 da parte di 2 è effettivamente dipendente dal legame con HIF-2α, abbiamo esaminato gli effetti dei ligandi sulle cellule Hep3B. Sebbene alcuni geni bersaglio inducibili dall'ipossia siano regolati sia da HIF-1 che da HIF-2 in queste cellule, altri geni sono regolati esclusivamente da una singola isoforma 26, 27 . Per esaminare l'espressione EPO o PGK1 come marker surrogati per HIF-2 e HIF-1, rispettivamente, le cellule Hep3B sono state preincubate con 1 μM o 10 μM 2 per 2 ore e mantenute in condizioni normossiche o ipossiche (1% O 2 ) per 6 ore o 12 ore. Mentre l'ipossia induce sia l'espressione di mRNA di EPO che PGK1, solo l'induzione ipossica di mRNA di EPO è antagonizzata da 2 (Fig. 5b). L'incubazione con 2 non ha alcun effetto sull'espressione di PGK1 o sui livelli di mRNA HIF-1α e HIF-2α (Figura 11 aggiuntiva).

Se 2 agisce nelle cellule antagonizzando l'eterodimerizzazione di HIF-2, anche l'attività di legame al DNA di HIF-2 dovrebbe essere selettivamente compromessa. L'immunoprecipitazione di cromatina (ChIP) con anticorpi anti-HIF-1α o HIF-2α è stata utilizzata per misurare il legame del DNA HIF nelle cellule in coltura. Un aumento sia dell'HIF-1 che dell'HIF-2 che si lega a un elemento promotore HIF-sensibile è osservato in condizioni ipossiche, riflettendo l'aumento della stabilità di entrambe le subunità α. Tuttavia, l'attività legante il DNA di HIF-1 non è influenzata nelle cellule incubate con 10 μM 2, mentre l'attività legante il DNA di HIF-2 è sostanzialmente ridotta (Fig. 5c). Insieme, questi dati costituiscono una dimostrazione di principio che i ligandi di piccole molecole possono legare direttamente e selettivamente una cavità all'interno del dominio PAS-B del polipeptide HIF-2α. Il legame del ligando induce cambiamenti conformazionali nell'HIF-2α che interrompono la formazione dell'eterodimero HIF-2, antagonizzando l'attività di legame del DNA e la selettività dell'HIF-2 riducendo l'espressione dei geni bersaglio dell'HIF-2 nelle cellule viventi.

Discussione

Sono stati compiuti grandi progressi nel chiarire la relazione tra HIF, ipossia e progressione e metastasi del tumore (rivisto in rif. 19, 28). Sono state osservate maggiori quantità di HIF nei tumori umani del cervello, del seno, dei reni e delle ovaie, tra gli altri, e sono spesso associate ad una maggiore aggressività tumorale, resistenza terapeutica e mortalità 28 . Sebbene molta attenzione si sia concentrata sui collegamenti tra HIF-1α e il cancro, ci sono prove crescenti che l'HIF-2α è un fattore importante per un numero di tumori comuni 19, 29 . Ad esempio, un chiaro ruolo dell'HIF-2 nel cancro è stato definito per un certo numero di carcinomi a cellule renali carenti di VHL in cui gli effetti protumorigenici dell'HIF-2α stabilizzato non possono essere fenocopiati dall'HIF-1α 6, 7, 8 . Più recentemente, l'HIF-2α è stato riconosciuto come un importante bersaglio terapeutico in un numero di tumori geneticamente diversi 30, inclusi glioblastomi 31, 32 e carcinomi polmonari non a piccole cellule 33 . I meccanismi sottostanti responsabili di una preferenza HIF-2 in alcuni tumori rimangono oggetto di indagine, sebbene sia stata implicata la selettività nell'espressione, i geni target e i partner di interazione 19 .

L'accumulo e l'attività della subunità HIF-α sono fortemente indotti a seguito di una diminuzione dell'O 2 cellulare, come spesso si riscontra nei tumori. Sotto la normossia, la subunità α viene rapidamente degradata a seguito dell'idrossilazione dipendente da O 2 delle prolina chiave nel dominio di degradazione dipendente dall'ossigeno, reclutando l'ubiquitina ligasi pVHL 34, 35 . L'idrossilazione parallela dipendente da O 2 di asparagine nel dominio di transattivazione C-terminale HIF-α controlla anche la capacità di HIF di interagire con alcuni coattivatori trascrizionali 36, 37 . Tuttavia, l'HIF-α è spesso costantemente sovraregolato in maniera indipendente dall'O 2 nei tumori che contengono adeguate alterazioni genetiche alle vie di segnalazione oncogenica o ai geni soppressori del tumore. Questo scenario è meglio esemplificato dalle mutazioni che inattivano la pVHL e provocano la stabilizzazione costitutiva della subunità HIF-α, predisponendo i pazienti a carcinomi a cellule renali e una serie di altri tumori 38 . È stato anche dimostrato che le mutazioni a molte altre proteine ​​inducono costitutivamente l'HIF-α, sebbene con altri meccanismi 28 . Gli antagonisti HIF a piccole molecole che legano direttamente il fattore di trascrizione, indipendentemente dal meccanismo alla base della sua induzione, possono quindi avere utilità in una vasta gamma di studi sulla malattia.

HIF-2α fornisce un obiettivo particolarmente attraente per lo sviluppo di inibitori, data la cavità preformata presente nel suo dominio PAS-B. Tali cavità sono molto rare nei domini proteici di queste dimensioni, poiché compromettono un componente importante del nucleo idrofobo che normalmente stabilizza una piega proteica. Nonostante il suo sequestro dal solvente, abbiamo precedentemente dimostrato che questa cavità è accessibile ai ligandi di piccole molecole in vitro 17, 18 . Qui identifichiamo composti superiori che legano il dominio HIF-2α PAS-B con un K D ∼ 80 nM. Questa classe di composti induce cambiamenti conformazionali all'interno del dominio al momento del legame, con i cambiamenti identificati all'interfaccia critica del foglio β utilizzata per legare ARNT PAS-B (Figura 12 aggiuntiva). In particolare, si osservano cambiamenti comparabili nei domini PAS con i loro ligandi naturali affini nonostante le differenze nella struttura del ligando e nel meccanismo di attivazione, suggerendo un certo grado di conservazione nei loro principi di attivazione allosterica. Ad esempio, i domini PAS fotosensibili, che legano i cromofori della flavina in modo comparabile ai nostri ligandi artificiali HIF-2α, sfruttano un cambiamento nella configurazione del cofattore attraverso la formazione fotochimica di un legame proteina-flavina alla struttura del foglio β perturbante e legame alle proteine 14, 39 (Supplementare Fig.12).

Sebbene interazioni multiple proteina-proteina guidino l'eterodimerizzazione HIF, le modifiche allosteriche ligando-dipendenti al dominio PAS-B HIF-2α sono sufficienti per interrompere la formazione del complesso endogeno HIF-2 a lunghezza intera, con una corrispondente riduzione selettiva dell'attività HIF-2 nelle cellule viventi. Sebbene i domini HIF PAS siano stati implicati come target per gli iniibitori HIF 40, 41, questo è a nostra conoscenza il primo esempio in cui sono state chiarite le basi molecolari per l'attività composta. Ad esempio, recentemente è stato riportato che l'acriflavina antagonizza direttamente l'HIF quando si lega ai domini HIF-α PAS-B 41 . Tuttavia, poiché questo composto inibisce sia HIF-1 che HIF-2, una cavità interna PAS-B non è molto probabilmente il sito di legame rilevante poiché le differenze tra le isoforme conferiscono squisita specificità.

Sebbene inizialmente caratterizzati nel contesto del loro ruolo nel rilevamento dell'ossigeno, gli HIF rispondono a una moltitudine di segnali cellulari, inclusi i metaboliti cellulari. Ad esempio, la via mTOR sensibile ai nutrienti agisce a monte dell'espressione HIF-α, mentre i metaboliti intermedi del ciclo di Krebs influenzano l'attività delle idrossilasi HIF 42 . Sebbene i nostri risultati qui forniscano reagenti utili per l'inibizione dell'HIF-2, è allettante tentare di ipotizzare ulteriormente che tale tasca si sia evoluta per la regolazione dell'HIF-2 da parte dei metaboliti endogeni in vivo . Dal punto di vista strutturale, questa ipotesi è supportata dalla presenza di rare cavità di grandi dimensioni (come in HIF-2α PAS-B) più comunemente all'interno di apo forme di proteine ​​leganti il ​​ligando naturale (Figura 1 complementare). In tal caso, la futura delucidazione dei ligandi naturali cognati potrebbe fornire nuove informazioni sulla regolazione metabolica specifica delle isoforme degli HIF in contesti fisiologici e patologici.

metodi

Preparazione di proteine.

Domini HIF-2α PAS-B (240–350), HIF-2α PAS-B * (240–350, R247E), ARNT PAS-B (355–470) e ARNT PAS-B * (355–470, E362R) furono espressi e purificati come precedentemente descritto 18 . HIF-1α PAS-B (238-349) utilizzato per ITC e HIF-2α PAS-B utilizzato per studi NMR complessati con 2 sono stati espressi con un tag di fusione Gβ1 N-terminale 23 e purificati mediante scambio ionico Source-Q e Superdex S75 cromatografia ad esclusione STERICA. Per il dominio PAS-B HIF-1α, il tag Gβ1 non è stato rimosso, poiché la sua conservazione ha migliorato la solubilità del dominio PAS-B purificato.

I reagenti proteici AlphaScreen sono stati espressi come GST-HIF-2α PAS-B * e sue fusioni 6 -Gβ1-ARNT – PAS-B * -Flag, purificate con affinità (glutatione o Ni (II)) e cromatografia Superdex S75, equilibrate in AlphaScreen tampone del dosaggio (50 mM Tris (pH 7, 5), 100 mM di NaCl; 1 mM di ditiotreitolo) e congelato con flash nel liquido N 2 .

Analisi NMR.

Le assegnazioni di risonanza della spina dorsale proteica per il complesso HIF-2α PAS-B – 2 sono state determinate usando gli spettri HNCO, HNCACB e CBCA (CO) NH raccolti su uno spettrometro Varian Inova 600 MHz equipaggiato con il criopobo da un campione di 300 μM U- [ 13 C, 15 N] HIF-2α PAS-B, 350 μM 2 e DMSO 0, 4% in tampone NaCl 10 mM d 11 -Tris, pH 7, 3 e 20 mM usando NMRViewJ 43 . I dati raccolti a una seconda condizione (5 mM MES, pH 6, 5; 20 mM NaCl) sono stati utilizzati per risolvere le ambiguità derivanti dall'ampliamento degli scambi in un numero limitato di siti. Le differenze di spostamento chimico (Fig. 2a, b) sono state calcolate dalle assegnazioni di spina dorsale HIF-2α PAS-B 15 N- 1 H del complesso (qui) e apo forma 9

Image

AlphaScreen.

Le reazioni sono state eseguite in micropiastre contenenti 100 nM GST-HIF-2α PAS-B *, 100 nM ARNT-PAS-B * -Flag, 20 mM Tris-Cl (pH 7, 5), 100 mM NaCl, 1 mM DTT, 0, 02% Perline per donatore di glutatione AlphaScreen Tween-20, 1, 5 pg / μl (PerkinElmer) e perline di accettatore anti-bandiera AlphaLISA da 1, 5 pg / μl (PerkinElmer). Le scorte composte (100 ×) sono state preparate in DMSO. Le piastre sono state incubate al buio a temperatura ambiente con oscillazione delicata per 4 ore prima della raccolta dei dati utilizzando un lettore di micropiastre EnVision (PerkinElmer). Come controllo, i singoli domini PAS-B * sono stati sostituiti da una singola proteina (doppiamente marcata) GST-ARNT-PAS-B * -Flag (230 nM) in grado di reclutare entrambe le sfere per indurre un segnale AlphaScreen.

Test di legame con ligando NMR.

I composti sono stati titolati a concentrazioni di 125 μM e 250 μM in campioni di 200 μM uniformemente 15 domini HIF-2α e ARNT PAS-B marcati con N. I cambiamenti nell'intensità o nelle posizioni dei picchi negli spettri HSQC 15 N- 1 H indicavano un legame con i ligandi.

Calorimetria di titolazione isotermica di complessi proteina-piccola molecola.

I parametri termodinamici del legame di piccole molecole sono stati determinati utilizzando un calorimetro MicroCal VP-ITC. Le soluzioni proteiche sono state ampiamente dializzate contro tampone (Tris 50 mM (pH 7, 5), NaCl 20 mM e β-mercaptoetanolo 5 mM), che è stato successivamente utilizzato per preparare una soluzione composta abbinata diluendo da uno stock composto da 50 mM in DMSO 100% . I dati ITC raccolti per 1 sono stati acquisiti con DMSO al 5, 0% per migliorare la solubilità dei composti e i dati per 2 sono stati raccolti con DMSO allo 0, 02%. I controlli precedenti hanno dimostrato effetti modesti del 5% di DMSO sui parametri termodinamici misurati per i complessi di legante HIF, riducendo tipicamente le affinità di un fattore da due a quattro 17 . Ciascuna isoterma è stata registrata iniettando 200 μM di proteina (siringa) in soluzioni da 5 a 10 μM di composto (cellula), tenendo conto dei riscaldamenti di diluizione sottraendo i dati da una titolazione di controllo di 200 μM di proteina in una soluzione tampone-DMSO abbinata. I termogrammi erano adatti a un modello di rilegatura a sito singolo per estrarre i parametri di rilegatura di equilibrio.

Cristallografia.

Il composto 2 è stato co-cristallizzato come complesso ternario con l'eterodimero HIF-2α – ARNT PAS-B * 17, 18 . In breve, gli eterodimeri HIF-2α – ARNT PAS-B * sono stati cristallizzati in presenza di un eccesso stechiometrico di 2. I cristalli del complesso ternario sono cresciuti in gocce pendenti di 2 μl di complesso ternario 300 μM e 2 μl di precipitante (100 mM Bis-Tris (pH 5, 5–6, 0), 20 mM NaCl, 19–23% PEG 3350), che è stato integrato con il 25% PEG400 prima del congelamento in azoto liquido. I dati sulla diffrazione dei raggi X sono stati raccolti presso la Advanced Photon Source (Argonne National Laboratory, Argonne, IL), ID-19 della linea di luce a 100 K usando i raggi X 0, 97937-Å, che sono stati ridotti e ridimensionati con il pacchetto software HKL2000 44 . Le strutture sono state determinate, perfezionate e validate usando la suite software di cristallografia macromolecolare PHENIX 45 (versione 1.7.2-869) in collaborazione con il web server PRODRG2 46 per generare coordinate iniziali del ligando, modellistica molecolare con COOT 47, validazione con MolProbity 48 e analisi aggiuntiva e preparazione della figura in PyMOL (Schrödinger, Inc.). Il modello strutturale finale è stato perfezionato con un'occupazione di 2 a 0, 7, con le statistiche di raffinamento finale presentate nella tabella supplementare 2 (coordinate depositate presso RCSB con codice PDB 4GHI). Le posizioni atomiche dell'idrogeno calcolate sono state aggiunte ai file di coordinate di proteine ​​e ligandi e sono state utilizzate in modalità "guida-idrogeno". Il modello finale mostra buone proprietà stereochimiche, a cui accedono Ramachandran (favorito al 100%) e MolProbity (3, 17 (98%) e Clash 1, 24 (96%) MolProbity. È stata calcolata una mappa di differenza di densità di elettroni F o - F o (Fig. 2c e Fig. 12a supplementare) utilizzando le ampiezze del fattore di struttura della differenza derivate dai dati di diffrazione associati a apo e ligando, con fasi derivate dalle coordinate atomiche dell'eterodimero della proteina apo (Codice PDB 3F1P 18 ). Le ampiezze dei fattori di struttura sono state ridimensionate utilizzando SCALEIT e le mappe sono state calcolate utilizzando FFT, entrambe dalla suite di software CCP4 (rif. 49). Il modello di omologia di HIF-1α PAS-B (Fig. 4a, b) è stato generato con MODELLER 50 utilizzando le coordinate prive di leganti di HIF-2α PAS-B (codice PDB 3F1P).

Le occupazioni per i siti che dimostrano conformatori multipli sono state ottimizzate da phenix.refine incluso il residuo di rivestimento di cavità HIF-2α PAS-B Met252. Come 2 dimostra un'occupazione frazionaria (0.7) dei siti di legame nel cristallo, entrambe le conformazioni apo (Met252-in) e 2-bound (Met252-out) sono rappresentate in mappe di densità F o -D F 2m (Figura 4) . La conformità Met252-in non è modellata nella struttura finale per chiarezza. L'occupazione frazionaria di 2 è probabilmente una conseguenza dei vincoli sterici imposti dalla crescita di cristalli HIF-2α PAS-B * –2 nelle stesse condizioni precedentemente utilizzate per la crescita di cristalli eterodimeri. Questo approccio potrebbe limitare i cambiamenti conformazionali delle proteine ​​indotti dal composto associati alla rottura dell'eterodimero PAS-B *, riducendo le affinità composte da HIF-2α PAS-B * e le occupazioni dei ligandi nel complesso ternario.

Identificazione della cavità sepolta.

Sono state rilevate cavità inaccessibili ai solventi e i volumi sono stati quantificati utilizzando un programma software basato su Python sviluppato appositamente per localizzare cavità interne sepolte (disponibile su richiesta). Il programma utilizza una ricerca basata sulla griglia per identificare le regioni all'interno dell'involucro molecolare accessibile ai solventi in cui una sfera della sonda 1.4-Å, che si avvicina a una molecola d'acqua, può essere posizionata senza scontrarsi stericamente con le proteine. I punti occupati dalla sonda adiacente sono stati raggruppati iterativamente in gruppi con una spaziatura della griglia successivamente più fine. Ad ogni stadio, i cluster che si estendono al solvente vengono eliminati. Infine, sono stati determinati i volumi dei cluster contigui che rimangono. Questo approccio è stato applicato a un sottoinsieme non ridondante del PDB generato sulla base dell'omologia di sequenza tra strutture di cristalli di raggi X di 2, 5 Å o risoluzione migliore (generata dallo strumento NCBI VAST, set di dati non identici = 32.263 catene a febbraio 2012). Sono state escluse dall'analisi cavità contenenti registrazioni HETATM non acquatiche, comunemente utilizzate per ligandi e cofattori. Questa analisi ha rivelato 121.433 cavità con un volume medio di 38, 9 Å 3 .

Coltura cellulare.

Adenocarcinoma renale umano 786-0 e carcinoma epatocellulare Le cellule Hep3B (AATC) sono state coltivate in mezzo di glucosio ad alto contenuto di DMEM (HyClone) integrato con FBS (Atlanta Biologicals) al 10% (786-0) o 15% (Hep3B), 20 mM HEPES pH 7, 4, 1 mM di piruvato di sodio, 100 U / ml di penicillina e 100 μg / ml di streptomicina (Invitrogeno). Esperimenti ipossici condotti in un incubatore dedicato (Coy Laboratory Products Inc) contenente 1% O 2, 5% CO 2 e bilancio N 2 . I composti sono stati aggiunti in DMSO (1% finale).

RT-PCR.

Le cellule sono state raccolte con Trizol (Invitrogen) e l'RNA totale è stato estratto utilizzando il Mini Kit RNeasy (Qiagen). Dopo il trattamento con DNasi, il cDNA è stato sintetizzato usando la trascrittasi inversa SuperScript II (Invitrogen). La RT-PCR quantitativa in tempo reale è stata eseguita in triplice copia utilizzando iTaq SYBR Green Supermix con ROX (Bio-Rad) con il sistema di rilevamento 7900HT e il prisma software (Applied Biosystems, Inc.). I dati sono stati analizzati utilizzando il metodo comparativo C T 51 e l'espressione è stata normalizzata in ciclofilina B. I dati per ciascun gene sono la media di tre valori determinati da tre set raccolti indipendentemente. I seguenti set di primer sono stati usati per amplificare Cyclophilin B: (TGCCATCGCCAAGGAGTAG; TGCACAGACGGTCACTCAAA), HIF-2α (GCGACAATGACAGCTGACAA; CAGCATCCCGGGACTTCT), EPO (GAGGCCGAGAATATCACGACGGG; TGCCCGACCTCCATCCTCTTCCAG), HIF-1α (TGCCACATCATCACCATATAGAGA; TCCTTTTCCTGCTCTGTTTGG), PGK1 (TTAAAGGGAAGCGGGTCGTTA; TCCATTGTCCAAGCAGAATTTGA) e VEGF1 (CTACCTCCACCATGCCAAGTG; TGATTCTGCCCTCCTCCTTCT).

Coimmunoprecipitation.

Sono stati condotti esperimenti di estrazione di proteine ​​nucleari e di co-IP come precedentemente riportato 52 . I seguenti anticorpi sono stati usati per l'analisi dell'immunoblot: anticorpo monoclonale di topo anti-HIF-1α (BD Biosciences; cat. N. 610959; diluizione 1: 400); anticorpo monoclonale di topo anti-EPAS / HIF-2α (Novus Biological; NB 100–132; diluizione 1: 400) e anticorpo monoclonale di topo anti-ARNT / HIF-1β (Santa Cruz Biotechnology; sc-17811; diluizione 1: 800).

Immunoprecipitazione di cromatina (ChIP).

Gli esperimenti sono stati condotti come descritto 53 usando il kit enzimatico ChIP-IT Express (motivo attivo) secondo il protocollo del produttore. I saggi di ChIP sono stati eseguiti utilizzando IgG di topo normale (Santa Cruz Biotechnology; n. Cat. # 2027; 1–2 μg / ml), anticorpo monoclonale di topo anti-HIF-2α (Novus Biologicals; NB 100–132; 2 mg / ml ) o anticorpo monoclonale di topo anti-HIF-1α (BD Biosciences; cat. no. 610958; 2 mg / ml). Il DNA genomico, precipitato da una singola piastra di 15 cm per ciascun trattamento e mantenuto in parallelo a quei campioni utilizzati nelle analisi dell'espressione genica, è stato analizzato da qPCR utilizzando i primer per un amplicone potenziatore EPO umano (ACTCCTGGCAGCAGTGCAGC; CCCTCTCCTTGATGACAATCTCAGC). Il DNA genomico catturato è stato normalizzato e confrontato tra i campioni come precedentemente riportato 26, 53 .

786-0 test di stabilità metabolica.

786-0 cellule di ATCC (Manassas, VA) sono state placcate a 5.000 cellule per pozzetto in 50 μL in piastre da 96 pozzetti e lasciate aderire durante la notte in un terreno di crescita RPMI standard contenente 10% FBS, glutammina 2 mM, 1 × penicillina-streptomicina, 10 mM HEPES, 1 mM di piruvato di sodio e 1 × aminoacidi non essenziali (tutti acquistati da Life Technologies, Grand Island, NY). Il composto 2 è stato sciolto in DMSO a 2 mM, ulteriormente diluito a 4 μM in mezzo HI e aggiunto alle cellule in 50 μL in modo che la concentrazione finale del composto fosse 2 μM. Due pozzetti aggiuntivi contenenti composto e nessuna cella sono stati placcati per servire come tempo 0 ( C 0 ) e controllo del solvente del punto finale ( C ep ). Le cellule sono state quindi poste in un incubatore a 37 ° C, 5% di CO 2 . Ad ogni momento, il mezzo è stato raccolto, le cellule sono state lavate una volta con PBS e il lavaggio è stato aggiunto al mezzo, e infine le cellule sono state tripsinizzate e il contenuto è stato aggiunto alla provetta contenente mezzo e PBS. Un volume uguale di metanolo è stato aggiunto per lisare le cellule e precipitare le proteine. I campioni sono stati incubati per 10 minuti a temperatura ambiente e quindi centrifugati a 15.000 g per 5 minuti in una microcentrifuga. Il surnatante è stato analizzato da LC-MS / MS. Metodi analitici sono stati sviluppati per 2 utilizzando un Applied Biosystems (Foster City, CA) 3200-QTrap, uno strumento combinato trappola triplo quadrupolo-ione. Lo ione genitore e i due ioni figlia più importanti sono stati seguiti per confermare l'identità composta, sebbene solo la figlia più abbondante sia stata utilizzata per la quantificazione. Per la cromatografia è stata utilizzata una colonna Agilent (Santa Clara, CA) ZORBAX XDB-C18, confezione da 5 μm dimensioni 4.6 mm × 50 mm.

Un metodo modificato 54 è stato usato per determinare l'emivita di stabilità metabolica per esaurimento del substrato. In breve, è stato calcolato un numero di "percentuale recuperata" per i campioni epossidici C 0 e C placcati in mezzo solo per controllare problemi relativi ai composti come la solubilità e la stabilità nel mezzo di analisi. Questo valore è stato ottenuto dividendo l'area del picco C ep LC-MS / MS per l'area del picco C 0 e moltiplicandola per 100. In genere, i valori accettabili sono compresi tra il 70 e il 140% 55, sebbene per i composti con percentuali inferiori siano riportate emivite valori recuperati. Un valore 'percentuale rimanente' è stato usato per valutare la stabilità metabolica di un composto nel tempo. L'area di picco LC-MS / MS del campione incubato in ciascun punto temporale è stata divisa per l'area di picco LC-MS / MS del campione temporale 0 ( T 0 ) e moltiplicata per 100. Il log naturale (ln) della percentuale del residuo residuo è stato quindi tracciato rispetto al tempo (in min) e una curva di regressione lineare è stata tracciata attraversando l'intercetta y in ln (100). Il metabolismo di alcuni composti non riesce a mostrare una cinetica lineare in un momento successivo, quindi questi punti temporali sono esclusi. L'emivita ( t 1/2 ) è stata calcolata come t 1/2 = 0, 693 / pendenza.

Ulteriori informazioni sulla sintesi chimica e dati sulla caratterizzazione chimica sono forniti nella Nota integrativa.

Codici di adesione.

Protein Data Bank (PDB): i dati cristallografici per HIF-2α – ARNT PAS-B * –2 sono depositati con il codice di adesione 4GHI.

adesioni

Accessioni primarie

Banca di dati proteici

  • 4GHI
  • 4GHI vista 3d

Accessioni di riferimento

Banca di dati proteici

  • 3F1P
  • 3F1P vista 3d

Informazione supplementare

File PDF

  1. 1.

    Testo e cifre supplementari

    Nota supplementare, risultati supplementari