Duplice ruolo della fratassina proteica mitocondriale nei tumori astrocitici | indagine di laboratorio

Duplice ruolo della fratassina proteica mitocondriale nei tumori astrocitici | indagine di laboratorio

Anonim

Soggetti

  • Cancro al sistema nervoso centrale
  • Proteine ​​mitocondriali
  • Proteine ​​tumorali-soppressori

Astratto

La fratassina proteica mitocondriale (FXN) è nota per essere coinvolta nell'omeostasi del ferro mitocondriale e nella biogenesi del cluster ferro-zolfo. Si discute per modulare la funzione della catena di trasporto degli elettroni e la produzione di specie reattive dell'ossigeno (ROS). La perdita di FXN nei neuroni e nelle cellule del muscolo cardiaco provoca un disturbo mitocondriale autosomico dominante, l'atassia di Friedreich. Recentemente, l'induzione del tumore dopo delezione mirata di FXN nel fegato e inversione del fenotipo tumorigenico delle cellule di carcinoma del colon in seguito a sovraespressione di FXN sono state descritte in letteratura, suggerendo una funzione di soppressione del tumore. Abbiamo ipotizzato che una parziale inversione del fenotipo maligno delle cellule di glioma dovrebbe verificarsi dopo la trasfezione FXN, se la proteina mitocondriale ha funzioni di soppressione del tumore in questi tumori cerebrali. Nei tumori cerebrali astrocitici e nelle linee cellulari tumorali, abbiamo osservato livelli ridotti di FXN rispetto agli astrociti non neoplastici. Il contenuto mitocondriale (attività citrato sintasi) non è stato significativamente modificato nelle cellule di glioblastoma U87MG che sovraesprimono stabilmente FXN (U87-FXN). Sorprendentemente, le cellule U87-FXN hanno mostrato un aumento dei livelli di ROS citoplasmatici, sebbene il rilascio di ROS mitocondriale sia stato attenuato da FXN, come previsto. Livelli di ROS citoplasmatici più elevati corrispondevano a attività ridotte di glutatione perossidasi e catalasi e contenuto di glutatione inferiore. Il difetto della capacità antiossidante ha comportato una maggiore suscettibilità delle cellule U87-FXN contro lo stress ossidativo indotto da H 2 O 2 o butionina solfoximina. Queste caratteristiche possono spiegare una maggiore sensibilità nei confronti della staurosporina e dei farmaci alchilanti, almeno in parte. D'altra parte, le cellule U87-FXN hanno mostrato tassi di crescita migliorati in vitro in condizioni ipossiche e limitate dal fattore di crescita e in vivo usando xenotrapianti tumorali in topi nudi. Questi dati contrastano con una funzione generale di soppressione del tumore della FXN, ma suggeriscono un doppio ruolo pro-proliferativo ma chemosensibilizzante nei tumori astrocitici.

Principale

Un'espansione ripetuta del GAA nel gene della fratassina provoca il disturbo letale atassia di Friedreich (FRDA), che è caratterizzata da degenerazione di tratti spinocerebellari, colonne dorsali e tratti piramidali, nonché insufficienza cardiaca. La mutazione abolisce la trascrizione genica, portando a una perdita della fratassina proteica mitocondriale (FXN), all'accumulo di ferro mitocondriale e allo stress ossidativo. 1, 2 Il knockout dell'omologo FXN Yfh1p nei lieviti compromette la respirazione e causa l'esaurimento del DNA mitocondriale e l'accumulo di ferro. 3, 4 Difetti delle proteine ​​ferro-zolfo nelle biopsie miocardiche dei pazienti FRDA hanno confermato una biogenesi del cluster ferro-zolfo (ISC) difettosa nel modello knockout Yfh1p. 5 Secondo la vista attuale, la FXN dei mammiferi è direttamente coinvolta nella biogenesi dell'ISC, 6 i cui passaggi centrali avvengono nella matrice mitocondriale. Gli oligomeri FXN mostrano una grande capacità di legare il ferro ferroso. Dopo aver legato FXN alla proteina dell'impalcatura ISC, il ferro può essere consegnato direttamente agli ISC senza metallo, che vengono poi trasferiti ai loro obiettivi finali. 7 proteine ​​ISC includono complessi della catena di trasporto degli elettroni (ETC) o ferrochelatasi, un enzima della biogenesi dell'eme. 8 FXN è quindi essenziale per la funzione dei complessi ETC contenenti ISC ed eme e del citocromo c.

Nelle cellule tumorali, FXN è stato discusso come un modulatore del metabolismo energetico, con un impatto sulle caratteristiche di crescita. Le linee cellulari di carcinoma del colon trasformate in FXN mostravano una respirazione migliorata ed erano caratterizzate da una riduzione dei tassi di crescita nei test su agar morbido e topi nudi. 9 Questi risultati sono stati interpretati in termini di inibizione della crescita del cancro dalle proprietà antiossidanti di FXN, portando a un potenziamento della fosforilazione ossidativa (OXPHOS). L'esperimento reciproco è stato un knockout FXN specifico per epatociti nei topi. L'induzione di più tumori epatici con ridotto metabolismo mitocondriale e proteine ​​ferro-zolfo ha suggerito una funzione di soppressione del tumore per FXN. 10

I tumori astrocitici maligni sono tra le neoplasie intracraniche più frequenti. Nonostante i recenti progressi della chemioterapia, il miglioramento della sopravvivenza globale mediana dei pazienti con glioblastoma (GBM) rimane una grande sfida. 11 In questo rapporto, abbiamo studiato il ruolo di FXN nei tumori astrocitici e nelle linee cellulari GBM. Abbiamo ipotizzato che il comportamento biologico maligno delle cellule tumorali astrocitiche, in particolare per quanto riguarda la crescita del tumore, dovrebbe essere attenuato dalla trasfezione FXN in vitro e in vivo , se la proteina ha proprietà di soppressione del tumore in queste cellule. Se questi effetti biologici fossero associati alle proprietà antiossidanti e protettive di OXPHOS suggerite da FXN, le cellule trasfettate dovrebbero esercitare una generazione di specie reattive di ossigeno (ROS) inferiore e una maggiore attività dell'aconitasi. Inoltre, è probabile che le cellule trasfettate siano meno sensibili allo stress ossidativo applicato esternamente.

MATERIALI E METODI

Costruzione vettoriale

pCl-neo-FXN è stato generato clonando un cDNA umano di fratassina marcato con emoagglutina in pCl-neo (Promega, Mannheim, Germania).

Coltura cellulare

Le linee cellulari GBM U87MG, U118MG, U138MG e LN405 sono state acquistate rispettivamente dalla American Type Culture Collection (ATCC) o dalla German Collection of Microorganisms and Cell Cultures. Linee cellulari trasformate U87-FXN e U87-Neo sono state generate dalla trasfezione da lipofectamina-2000 dei plasmidi in cellule U87MG e in coltura sotto 0, 2 mg / ml G418. Questa concentrazione era stata determinata come concentrazione minima, che uccide le cellule dei genitori entro 2 settimane. Le colonie in via di sviluppo di cellule resistenti sono state trasferite selettivamente nel nuovo pallone e mantenute sotto G418. Le linee cellulari utilizzate nel presente studio rappresentano quindi i cloni cellulari. Gli astrociti corticali umani sono stati acquistati da ScienCell Research Laboratories (Carlsbad, CA) e astrociti embrionali di ratto preparati nel nostro laboratorio. 12 Tutte le cellule sono state coltivate in DMEM con FCS al 10%. L'identità delle linee cellulari è stata analizzata utilizzando il kit AmpFSTR e il software GeneMapper ID v3.2 (Applied Biosystems), consentendo l'identificazione automatica di alleli di 11 marcatori cromosomici polimorfici e amelogenina mediante PCR multiplex fluorescente. Le linee transgeniche U87-FXN e U87-Neo mostravano modelli identici per tutti i marker analizzati, dimostrando che queste linee cellulari erano derivati ​​delle cellule U87MG, che erano state originariamente ottenute dall'ATCC. Tre di questi marker, amelogenin (X), vWA (alleli 15, 17) e THO1 (allele 9.3) sono pubblicati per la linea parentale U87MG nel database ATCC (//www.ATCC.org). L'OLN-93 è stato originariamente derivato da una cultura gliale cerebrale di ratto primaria e ricorda gli oligodendrociti primari. È stato un gentile dono del professor Richter-Landsberg (Dipartimento di Biologia, Università di Oldenburg, Germania), che per primo ha descritto la linea.

Tessuti tumorali umani

I campioni congelati sono stati prelevati dagli archivi del Dipartimento di Neuropatologia dell'Università Otto-von-Guericke. I campioni erano stati ottenuti durante l'escissione neurochirurgica di routine dei campioni a fini diagnostici. La diagnosi era stata eseguita da un neuropatologo esperto (CM).

Colture miste di cellule cerebrali di ratto

Colture miste neuronali / gliali sono state preparate dal cervelletto di ratti di 4 giorni in DMEM con 10% FCS e 1% (v / v) penicillina / streptomicina. Dopo dispersione meccanica, le aliquote della sospensione sono state placcate in piatti rivestiti con poli-D-dialina ad una densità finale di 2 × 10 6 celle per 8 cm 2 . Dopo 48 ore, le cellule non aderenti sono state rimosse per media variazione. Dopo 10 giorni, le cellule sono state utilizzate per esperimenti. Per la privazione di siero / glucosio (SGD) , il terreno di crescita è stato sostituito da DMEM privo di siero e glucosio per 24 ore.

PCR qualitativa e in tempo reale

L'RNA è stato isolato utilizzando i mini-kit RNeasy di Qiagen (Hilden, Germania). FXN-PCR da cDNA è stato eseguito con i primer TAAGCGTTATGACTGGACTGG e GAATAGGCCAAGGAAGACAAG, β -actina (ACC ACC CCA GCC ATG TAC G e ATG TCA CGC ACG ATT TCC C) che serve come riferimento. Per la PCR Real-Time basata su SYBR su un ABI-7000-SDS (Applied Biosystems, CA), sono stati usati gli stessi primer con identica temperatura di ricottura (57 ° C).

Western Blotting

Le cellule sono state lavate due volte con PBS ghiacciato e raccolte raschiando in tampone RIPA (10 mM Tris-HCl, pH 7, 4; NaCl 150 mM; 50 mM NaF; 1 mM EDTA; 1% Triton X-100; 0, 1% SDS; 0, 5 % desossicolato) con DTT, Na-vanadato e inibitori della proteasi. Complessivamente, 40 μ g di proteina sono state separate da SDS-PAGE e trasferite su membrane di nitrocellulosa. Dopo il blocco, le membrane sono state incubate con anticorpi primari in TBST durante la notte a 4 ° C, seguite da chemiluminescenza (Millipore, Schwalbach, Germania). Gli anticorpi primari erano diretti contro la fratassina (Mitoscienze, 1: 300) e la β -attina (SIGMA, 1: 1000).

immunofluorescenza

Le colture sono state lavate due volte con PBS, fissate per 30 minuti usando paraformaldeide al 4% in PBS. Dopo una fase di blocco con siero di capra all'1% per 30 minuti, le cellule sono state incubate per 3 ore a temperatura ambiente con anticorpi in PBS con 0, 3% di Triton X-100 e siero di capra all'1%: antifratossina di coniglio (H-155, Santa Cruz Biotecnologia, Santa Cruz, 1: 500) in combinazione con mouse anti-GFAP (Chemicon, Temecula, 1: 1000), mouse anti-MAP2 (Chemicon, 1: 2500), mouse anti-NG2 (Chemicon, 1: 500), S100b anti-topo (Chemicon, 1: 100) o un anticorpo anti-Isolectin B4 coniugato con biotina di ratto (Vector Laboratories Inc., Burlingame, CA; 1: 100). La specificità delle immunoreazioni è stata controllata mediante l'applicazione di un tampone anziché di anticorpi primari, che non ha mai prodotto immunocolorazione. Le colture sono state lavate in PBS (3 × 5 min) e incubate per 3 ore con una combinazione di anticorpi secondari (Sonde Molecolari, Gottinga, Germania; 1: 500): IgG anti-coniglio di capra Alexa Fluor 546 / anti-topo di capra- IgG Alexa Fluor 488. Poiché l'anticorpo IB4 è coniugato con biotina, qui il passaggio dell'anticorpo secondario includeva solo l'uso di IgA Alexa Fluor 546 anti-coniglio.

Saggi MTT, Crystal Violet e BrdU

Per valutare la frazione cellulare sopravvissuta, dopo il trattamento delle cellule in micropiastre a 96 pozzetti sono stati eseguiti test 3- (4, 5-dimetiltiazol-2-il) -2, 5-difeniltetrazolio (MTT) o cristallo viola dopo il trattamento delle cellule . Le cellule sono state colorate per 2 ore con 0, 75 mg / ml di sale MTT a 37 ° C, lisate in 100 microlitri dimetil solfossido e l'assorbanza è stata letta a 562 nm. Per la determinazione della sensibilità all'ipossia, quantità uguali di cellule sono state seminate in boccette di colture cellulari e incubate per 24 o 48 ore (come indicato nella Figura 5) o nel consueto incubatore in condizioni normossiche (controllo) o in un'ipossia profumata con N 2 camera con 5% di CO 2, ma solo 0, 1% di ossigeno. I test MTT sono stati eseguiti immediatamente dopo il periodo di incubazione, ma in condizioni normossiche. I segnali rappresentano quindi il numero di cellule presenti, ma non le differenze nella saturazione mitocondriale dell'ossigeno. Per i saggi di cristallo viola, le cellule sono state colorate con 50 μl di 0, 5% di cristallo viola e 20% di metanolo per 15 minuti. Dopo quattro lavaggi, i pozzetti essiccati sono stati incubati per 20 minuti con 200 μl di metanolo e misurati a 595 nm. La percentuale di cellule vitali è stata definita come densità ottica rispetto ai controlli non trattati. 13 Per la determinazione della proliferazione cellulare (sintesi del DNA), è stato utilizzato il dosaggio basato su BrdU di Roche (Mannheim).

Saggi enzimatici e GSH

Le attività di glutatione perossidasi (GPx) e catalasi (CAT) e glutatione totale sono state determinate in lisati di cellule fresche generate dalla sonicazione di cellule in PBS utilizzando il kit GPx-340 di Oxis Research (Foster City, CA), il kit di analisi catalasi di Calbiochem (Darmstadt, Germania) e il kit di analisi GSH di Sigma (Taufkirchen, Germania). L'attività dell'aconitasi è stata misurata con una miscela di reazione contenente 60 mM di citrato di sodio, 0, 4 mM NADP +, 0, 6 mM MnCl 2 e 4 U / ml di isocitrato deidrogenasi disciolti in Tris-HCl 50 mM, pH 7, 4. L'assorbanza è stata letta a 340 nm nel lettore di piastre.

Il saggio per citrato sintasi (CS), un marcato enzima mitocondriale marcatore, si basa sulla reazione mediata da CS di acetil-CoA con ossaloacetato in citrato e coenzima libero A. Il coenzima A reagisce con il reagente di Ellman (5, 5′-dithiobis ( Acido 2-nitrobenzoico)) a acido 2-nitro-5-tiobenzoico, che viene quantificato per assorbanza a 412 nm.

Dosaggio DCF fluorimetrico

Le cellule sono state risospese in PBS con 20 mM di glucosio ad una densità di 20.000 cellule / ml e immediatamente caricate con 2 μ M di DCFH-diacetato per 15 minuti a 37 ° C. DCFH-DA viene idrolizzato in DCF, una sonda fluorescente per il rilevamento di ROS (eccitazione a 458 nm ed emissione a 520 nm), che consente il monitoraggio dipendente dal tempo della generazione di ROS intracellulare a 25 ° C.

Isolamento dei mitocondri

Per isolare i mitocondri dalle cellule, 2 × 10 7 cellule sono state sospese in 0, 8 ml di terreno a base di saccarosio ghiacciato (250 mM di saccarosio, 5 mM Hepes, 0, 1 mM EDTA, pH 7, 2) e omogeneizzate utilizzando un omogeneizzatore Dounce. Dopo l'aggiunta di 0, 8 ml di terreno a base di saccarosio, la miscela è stata centrifugata (700 g , 10 minuti a 4 ° C). Il supernatante risultante è stato nuovamente centrifugato (12000 g , 15 minuti a 4 ° C). Il pellet mitocondriale è stato lavato una volta nel mezzo a base di saccarosio e risospeso in 0, 5 ml dello stesso mezzo. Il contenuto proteico di questa sospensione di stock è stato misurato dal BioRad Protein Kit.

Generazione ROS mitocondriale

La generazione di ROS mitocondriale è stata stimata come rilascio di H 2 O 2 utilizzando il sistema Amplex Red (AR) / perossido di rafano (37 ° C). In breve, i mitocondri (0, 4 mg di proteine ​​/ ml) sono stati incubati in terreno integrato con 5 μ M AR più HRP (2 unità / ml) per rilevare il rilascio di H 2 O 2 . L'AR non fluorescente viene ossidato da H 2 O 2 alla resorufin fluorescente. La fluorescenza di quest'ultimo composto è stata monitorata fluorimetricamente a 37 ° C usando uno spettrometro a fluorescenza Perkin-Elmer Life Sciences LS-50B (eccitazione a 560 nm ed emissione a 590 nm). Il mezzo di incubazione conteneva 110 mM di mannitolo, 60 mM KCl, 60 mM Tris-HCl, 10 mM KH 2 PO 4, 0, 5 mM EGTA (pH 7, 4) e 5 mM piruvato più 5 mM di malato. I cambiamenti nella fluorescenza di resorufin sono stati calibrati con H 2 O 2 .

Crescita tumorale nei topi nudi

In tutto, 3 × 10 5 cellule tumorali incorporate nel matrigel sono state iniettate per via sottocutanea nei fianchi dei topi nudi svizzeri (Crl: Nu (Ico) -Fox1) (Charles River Laboratories, Germania). La sperimentazione sugli animali è stata condotta secondo le approvazioni del comitato etico locale. Durante un periodo di 6 settimane, i volumi del tumore sono stati stimati mediante misurazione esterna di lunghezza e larghezza e calcolati secondo la formula ( xy 2 ) / 2, x > y . Dopo 6 settimane, i tumori sono stati rimossi dagli animali uccisi e sono stati determinati il ​​peso del tumore e il contenuto totale di GSH. L'istologia tumorale è stata analizzata in sezioni H&E di routine da un neuropatologo (CM).

statistica

Confronti multipli sono stati eseguiti con un ANOVA, seguito dal test post hoc Tukey. Un test t bilaterale è stato utilizzato per valutare gli esperimenti confrontando solo due trattamenti o linee cellulari. È stato assunto significato per P ≤0, 05. Tutti i calcoli sono stati eseguiti con il pacchetto software SPSS, versione 14.0.

RISULTATI

Espressione di fratassina nelle cellule gliali e nei tumori astrocitici

Sebbene FXN sia rilevabile negli oligodendrociti 14 e negli astrociti, finora non sono stati analizzati 15 tumori gliali. Come mostrato nella Figura 1a, le colture di cellule miste non stimolate (A – E) hanno mostrato espressione di FXN nelle cellule differenziate neuronicamente (A), negli oligodendrociti (C), nelle cellule precursori (D) e in quantità notevoli nelle cellule microgliali (E), mentre è stato rilevato solo scarsamente negli astrociti (B). SGD (F – J) ha provocato un aumento dell'espressione di FXN specialmente negli astrociti (G). Quest'ultimo esperimento è stato eseguito tre volte in modo indipendente e le macchie in tre piatti di coltura sono state eseguite per esperimento. In tutti e nove i piatti, l'ispezione visiva ha rivelato una frazione più elevata di cellule a doppia colorazione FXN / GFAP, sebbene non sia stata applicata alcuna misurazione quantitativa dei livelli di fluorescenza. La microfotografia (K) è un ingrandimento maggiore di (G), mentre L e M rappresentano altri due esperimenti indipendenti. Le microfotografie di ingrandimento più elevato mostrano meglio la colorazione mitocondriale FXN a punti (rossa) negli astrociti GFAP positivi (verdi). Questi dati suggeriscono che l'espressione di FXN è bassa negli astrociti a riposo, ma indotta dall'attivazione astrogliale dovuta allo stress cellulare. Poiché gli astrociti sono il tipo di cellula più comune che provoca neoplasie intracraniche, ci siamo chiesti se FXN abbia un ruolo nei tumori astrocitici.

Image

Espressione della fratassina (FXN) nelle cellule gliali e nei gliomi. ( a ) Una coltura cellulare mista di cervelletto di ratto mostra l'espressione di FXN nelle cellule neuronali (A), oligodendrogliale (C), precursore (D) e microgliale (E), mentre gli astrociti (B) sono in gran parte privi di colorazione FXN. In seguito all'induzione dello stress cellulare da deprivazione sierica / glucosio (SGD), questo sistema di coltura cellulare mostra una maggiore espressione di FXN negli astrociti (frecce in G), mentre in altri tipi di cellule l'espressione di FXN appare quasi invariata (F, H – J). (K – M) Mostra esempi per l'aspetto a punti della colorazione FXN con ingrandimento maggiore. L'mRNA di FXN è anche espresso nei tumori gliali umani di origine astrocitica ( b ), con riduzione quantitativa dei tumori astrocitici maligni di alto grado dei gradi OMS III e IV (astrocitoma anaplastico e glioblastoma) rispetto agli astrocitomi diffusi di grado II dell'OMS ( c ). ( d ) I livelli proteici di FXN sono ridotti negli astrocitomi. ( e ) Nelle linee di cellule tumorali astrocitiche, la proteina FXN è solo vagamente rilevabile nelle cellule U87MG ma sembra mancare nelle cellule U138MG e LN405. La linea oligodendrocitica OLN-93 non contiene FXN. I controlli positivi e negativi sono cellule di carcinoma del colon trasfettate stabilmente con FXN o vettore di controllo come riportato in Thierbach et al. 10

Immagine a dimensione intera

FXR mRNA era presente in tutti i tumori studiati (Figura 1b) e sembra verificarsi una riduzione nei tumori di alto grado (Figura 1c). Gli studi di Western blot hanno rivelato due bande di basso peso molecolare, che possono essere interpretate in termini di elaborazione in due fasi del precursore citoplasmatico da proteasi all'interno dei mitocondri, 16, 17 la proteina più piccola che rappresenta FXN maturo. Una marcata espressione di quest'ultimo negli astrociti era fortemente ridotta nei tumori astrocitici ( P <0, 05) secondo le scansioni densitometriche delle macchie occidentali (Figura 1d) e nelle linee cellulari tumorali (Figura 1e).

Impatto della FXN sul metabolismo mitocondriale e lo stress ossidativo nelle cellule di glioma umano

Abbiamo quindi chiesto se la reespressione di FXN potesse avere effetti benefici sul metabolismo mitocondriale ossidativo nelle cellule GBM e quindi invertire il fenotipo tumorigenico. 9 Abbiamo trasfettato stabilmente cellule U87MG con FXN di tipo selvaggio umano sotto il controllo di un promotore costitutivo (CMV), ulteriormente denominato U87-FXN.

Gli studi di immunofluorescenza hanno confermato la localizzazione mitocondriale di FXN negli astrociti di ratto normali (Figura 2a, A). Sebbene un certo grado di colorazione FXN a punti sia avvenuta in alcune cellule U87MG parentali (B), la co-colorazione perinucleare di FXN e mitotracker è stata chiaramente migliorata in U87-FXN rispetto alle cellule U87-Neo. Quasi tutte le cellule U87-FXN hanno mostrato una forte espressione FXN (C e D). Il Western blot ha dimostrato una massiccia induzione delle due proteine ​​mitocondriali FXN a basso peso molecolare (Figura 2b).

Image

Generazione di cellule U87MG con sovraespressione stabile di FXN. ( a ) Gli studi a doppia etichettatura usando un anticorpo anti-FXN (verde) e un mitotracker (rosso) rivelano la presenza di FXN in pochi astrociti di ratto (A), cellule U87MG di tipo selvatico (B) e cellule U87-Neo trasferite stabilmente con un vettore di controllo (C). Al contrario, le cellule U87-FXN che sovraesprimono stabilmente la fratassina (D) mostrano un forte segnale FXN con colocalizzazione ai mitocondri in quasi tutte le cellule. ( b ) Macchie occidentali che mostrano fratassina intermedia e matura nelle cellule U87-FXN (FXN), mentre la linea parentale U87MG (peso) e la linea finta transfetta (U87-Neo) mostravano solo un'espressione minima quando le macchie venivano incubate con un FXN anticorpo.

Immagine a dimensione intera

A causa della nota funzione di FXN nell'omeostasi del ferro, abbiamo analizzato i livelli proteici di ferritina, transferrina e proteina dell'impalcatura ISC mediante western blot, ma non abbiamo rilevato cambiamenti sostanziali (dati non mostrati).

A seguito dell'ipotesi di lavoro secondo cui la sovraespressione di FXN nelle cellule tumorali può attivare il metabolismo mitocondriale ossidativo e inoltre ridurre la generazione di ROS legata alla catena respiratoria, 9 abbiamo prima analizzato l'attività del CS come misura del contenuto mitocondriale totale. Le pendenze delle attività enzimatiche normalizzate dalle proteine ​​erano (1, 34 ± 0, 016) × 10 −3 / min / μ g per U87-FXN e (1, 18 ± 0, 017) × 10 −3 min / μ g per U87-Neo ( n = 6). Questo risultato ha escluso un forte impatto della sovraespressione di FXN sul contenuto mitocondriale totale, che quindi non dovrebbe avere alcun impatto sulla produzione totale di ROS delle cellule. Inoltre, l'attività di CS è stata determinata in quattro esperimenti indipendenti nei mitocondri isolati da quattro passaggi di colture cellulari. Le attività risultanti normalizzate alla proteina mitocondriale (6000 ± 2980 nmol / min / mg nelle cellule U87-FXN e 5900 ± 2500 nmol / min / mg nelle cellule U87-Neo) non hanno rivelato differenze sostanziali tra i due cloni.

L'attività dell'enzima aconitasi del ciclo di Krebs (ACO) è stata ora determinata da estratti di cellule intere, poiché ha essenzialmente bisogno di FXN per mantenere il suo contenuto di ISC ed è altamente vulnerabile al ROS intra-mitocondriale. 18 L'attività dell'aconitasi è stata aumentata di circa il 26% nelle cellule U87-FXN ( P <0, 05; Figura 3a). Abbiamo anche misurato l'attività dell'aconitasi nelle preparazioni mitocondriali di entrambi i cloni cellulari. Tre misure indipendenti (tre passaggi) sembravano supportare un'attività più elevata nelle cellule trasfettate FXN, sebbene la differenza non sia diventata statisticamente significativa a causa della grande variazione delle attività assolute tra le tre serie di esperimenti (dati non mostrati).

Image

Effetti della reespressione della fratassina sui livelli di ROS e stato di difesa antiossidante nelle cellule di glioblastoma. ( a ) L'aumentata attività dell'aconitasi nelle cellule U87-FXN (sei esperimenti indipendenti, P ≤0, 05) indica una riduzione dello stress ossidativo mitocondriale. ( b ) La valutazione diretta della produzione di ROS mediante la misurazione della fluorescenza DCF rivela un aumento dei livelli di ROS nelle cellule U87-FXN. Le tracce rappresentano un singolo esperimento scelto tra un totale di sei esperimenti indipendenti (passaggi di coltura cellulare), che hanno tutti mostrato segnali DCF più alti rispetto ad entrambe le altre linee cellulari, che avevano fluorescenza simile. ( c ) Registrazione del rilascio di H 2 O 2 da mitocondri isolati, utilizzando il sistema di rilevamento AR / HRP. Le tracce mostrate di fluorescenza di resorufin sono rappresentative per un totale di quattro esperimenti indipendenti. I tassi di rilascio di H 2 O 2 calcolati dalle tracce erano 135 pmol H 2 O 2 / min / mg di proteine ​​per U87-Neo, 156 pmol / min / mg per U87MG e 74 pmol / min / mg per cellule U87-FXN . Le frecce indicano l'aggiunta di mitocondri. ( d - f ) Determinazione dell'attività della glutatione perossidasi (GPx, d ), attività della catalasi ( e ) e glutatione ( f ) dimostrano una ridotta capacità antiossidante citoplasmatica nelle cellule U87-FXN (sei esperimenti indipendenti, * P ≤0, 05).

Immagine a dimensione intera

Se questo effetto dovesse dipendere da livelli ROS ridotti diminuiti generati dall'ETC, nelle cellule U87-FXN ci si aspetterebbero livelli più bassi di fluorescenza DCF. Il superossido viene rilasciato su entrambi i lati della membrana interna e viene convertito in H 2 O 2 da superossido dismutasi nel citoplasma (Cu / Zn-SOD) e nello spazio matrice (MnSOD). Il perossido di idrogeno nella matrice, che non è inattivato da GPx, sfugge ai mitocondri, migliorando la fluorescenza citoplasmatica DCF delle cellule caricate con DCFH-DA. Sorprendentemente, la fluorescenza è stata chiaramente migliorata nelle cellule U87-FXN rispetto alle cellule U87-Neo e U87MG (Figura 3b). Questi dati sono stati confermati dalle corrispondenti differenze nella fluorescenza Amplex Red, una misura del rilascio di ROS dalle cellule al mezzo (dati non mostrati). Al fine di valutare in modo più specifico la generazione di ROS mitocondriali in assenza di fonti di ROS citoplasmatiche e difese antiossidanti citoplasmatiche, abbiamo successivamente misurato la fluorescenza Amplex Red nelle sospensioni mitocondriali (Figura 3c). Il rilascio ROS più basso di sospensioni di mitocondri isolati da cellule FXN è in linea con la maggiore attività ACO. I più alti livelli di ROS citoplasmatici hanno suggerito di alterare le fonti di ROS non mitocondriali e / o le difese antiossidanti citoplasmatiche nelle cellule trasfettate da FXN.

Successivamente, abbiamo analizzato le difese antiossidanti. Entrambi gli enzimi di conversione di H 2 O 2, GPx e CAT, hanno mostrato una significativa riduzione delle cellule U87-FXN ( P <0, 01) a valori rispettivamente del 36, 8 e del 59, 5% (Figure 3d ed e). Il cofattore glutatione GPx (GSH) è stato significativamente ridotto anche nelle cellule U87-FXN (Figura 3f). Ciò ha suggerito un ruolo della riduzione della disintossicazione da H 2 O 2 per i segnali DCF e Amplex Red potenziati misurati in queste cellule. Non sono state osservate differenze significative rispetto all'attività totale di superossido dismutasi (dati non mostrati).

Il ridotto contenuto totale di GSH corrispondeva a una maggiore sensibilità delle cellule U87-FXN al composto che impoverisce la GSH buthionine sulfoximine (BSO) nei test MTT. L'inibizione della sintesi di GSH da parte del BSO dovrebbe avere un effetto più rapido nelle cellule con livelli basali inferiori di GSH. Dopo l'applicazione di 1 mM BSO per 24 ore, la percentuale di cellule vitali nei test MTT è stata ridotta al 44% nelle cellule U87-FXN rispetto all'81% nelle cellule U87-Neo in linea (Figura 4a). Inoltre, la riduzione della capacità disintossicante di H 2 O 2 spiega una sensibilità significativamente aumentata delle cellule U87-FXN verso alte dosi di H 2 O 2 applicato esternamente, che è stata valutata nei test MTT 24 h dopo l'applicazione in bolo di 100 o 1000 μ M H 2 O 2 (Figura 4b). L'aggiunta di una concentrazione moderata di 10 μ M H 2 O 2 (dati non mostrati) ha comportato una riduzione non significativa dei tassi di sopravvivenza cellulare, che inoltre non differiva tra i due cloni (93, 4% nelle cellule U87-FXN contro 94, 7% nell'U87 -Neo). Questi dati suggeriscono che le cellule GBM contenenti fratassina sono più sensibili allo stress cellulare indotto dagli ossidanti.

Image

Maggiore suscettibilità delle cellule di glioma che esprimono la fratassina a fattori di stress esterni. ( a ) L'applicazione di BSO (1 e 5 mM) che riduce i livelli di glutatione bloccando la sintesi de novo mostra che le cellule U87-FXN sono generalmente più sensibili delle cellule U87-Neo. ( b ) L'applicazione esterna del perossido di idrogeno alle cellule di glioma mostra una maggiore suscettibilità delle cellule U87-FXN (4 esperimenti indipendenti, 24 misurazioni per esperimento, * P ≤0, 05).

Immagine a dimensione intera

Vantaggio di crescita delle cellule contenenti astrocitoma contenenti fratassina

I saggi BrdU hanno ripetutamente indicato un tasso leggermente più alto di sintesi del DNA per U87-FXN su cellule U87-Neo nel DMEM contenente il 10% di FCS (dati non mostrati). Tuttavia, la differenza ha raggiunto la significatività statistica ( P ≤ 0, 001) solo se le cellule affamate di siero sono state stimolate con FCS all'1% (Figura 5a). Questi risultati hanno suggerito un vantaggio proliferativo per le cellule che sovraesprimono FXN in condizioni limitate dal fattore di crescita. La necrosi tumorale è un segno distintivo di GBM e una condizione in cui si verificano ipossia e offerta limitata con diversi fattori di crescita. Come mostrato nella Figura 5b, la diminuzione delle cellule vitali dopo periodi ipossici (0, 1% di ossigeno) di 24 e 48 ore era meno pronunciata in U87-FXN rispetto alle cellule U87-Neo, come determinato dal dosaggio MTT. Ciò suggerisce un vantaggio di crescita delle cellule contenenti fratassina. Per analizzare la crescita del tumore in vivo , abbiamo iniettato per via sottocutanea cellule di glioma immerse nel matrigel nei topi nudi. Gli animali iniettati con cellule U87-FXN hanno sviluppato tumori più grandi rispetto agli animali che trasportavano cellule U87-Neo. La valutazione settimanale dei volumi di tumore ha confermato un significativo vantaggio di crescita delle cellule U87-FXN (Figura 5c). I tumori U87-FXN erano altamente necrotici, mentre i tumori U87-Neo erano caratterizzati da una crescita più solida (Figura 5d).

Image

Lo stress cellulare migliora la sopravvivenza e la proliferazione cellulare delle cellule di glioma contenenti fratassina. ( a ) Se le cellule vengono coltivate in condizioni sieriche limitate (siero 1%), l'incorporazione di BrdU è significativamente più elevata nelle cellule U87-FXN ( *** P ≤0, 001, 4 esperimenti indipendenti, 24 misurazioni per esperimento). ( b ) La coltura cellulare in condizioni ipossiche rende le cellule U87-FXN meno sensibili delle cellule di controllo U87-Neo (4 esperimenti indipendenti, 24 duplicati tecnici, *** P ≤0, 001). I dati di sopravvivenza per le cellule U87MG dei genitori (dati non mostrati) non erano significativamente diversi da quelli delle cellule U87-Neo, vale a dire l'82, 3% dopo 24 ore e il 62, 8% dopo 48 ore di ipossia. ( c ) La crescita delle cellule U87-FXN nei topi nudi rivela un carico tumorale significativamente aumentato rispetto ai controlli ( ** P ≤0, 01). Sono stati eseguiti due esperimenti con due passaggi dei cloni cellulari. Ogni esperimento conteneva quattro topi, iniettati per via sottocutanea con cellule tumorali su entrambi i lati. ( d ) L'analisi istologica degli xenotrapianti tumorali mostra tumori in gran parte necrotici in topi iniettati con cellule U87-FXN, mentre le cellule U87-Neo mostrano una crescita solida senza necrosi.

Immagine a dimensione intera

La fratassina aumenta la sensibilità ai farmaci alchilanti e di induzione dell'apoptosi intrinseca

Le cellule U87-FXN sono più sensibili allo stress ossidativo esterno (H 2 O 2 ) rispetto alle cellule di controllo e, in generale, le cellule di glioma mostrano una sostanziale resistenza all'induzione dell'apoptosi da parte di farmaci chemioterapici. 19 Pertanto, ci siamo chiesti se il livello FXN delle cellule di glioma potrebbe modulare la sensibilità dell'apoptosi e gli effetti citotossici degli agenti alchilanti attualmente utilizzati per la terapia con glioma.

Innanzitutto, abbiamo testato la sensibilità verso la staurosporina, un noto fattore scatenante dell'apoptosi intrinseca. La staurosporina ha indotto una significativa perdita cellulare entro 24 ore. La curva di risposta alla dose per le cellule U87-FXN era chiaramente inferiore a quella per le cellule U87-Neo nell'intero intervallo di concentrazioni applicate (Figura 6a), suggerendo una suscettibilità generalmente migliorata delle cellule che esprimono FXN all'apoptosi intrinseca. Inoltre, la sopravvivenza cellulare dopo il trattamento con agenti alchilanti per 24 ore è stata ridotta nelle cellule U87-FXN (Figura 6b). La perdita cellulare è stata moderatamente ridotta, se le cellule sono state pretrattate per 1 ora con gli antiossidanti, inclusi nel mezzo durante il trattamento con BCNU (Figura 6c). Per supportare ulteriormente una possibile connessione tra sensibilità BCNU e stress ossidativo, abbiamo analizzato, se BCNU porta a livelli ROS di citoplasma migliorati. È stato osservato un moderato aumento della fluorescenza DCF dopo 2 ore di esposizione a 20 μ M di BCNU in cellule U87-FXN (16, 6%) e U87-Neo (12, 2%).

Image

Aumento della suscettibilità delle cellule di glioma contenenti fratassina agli induttori apoptotici e ai farmaci alchilanti. ( a ) I test di sopravvivenza cellulare mostrano una sopravvivenza significativamente ridotta delle cellule U87-FXN a seguito dell'induzione interna di apoptosi da parte della staurosporina. ( b ) I farmaci alchilanti comunemente usati per il trattamento dei gliomi sono più efficaci nelle cellule U87-FXN rispetto alle cellule di controllo. ( c ) Gli effetti dei farmaci alchilanti (BCNU) possono essere parzialmente salvati dall'applicazione concomitante di agenti antiossidanti (trolox e ascorbato) nelle cellule U87-FXN (4 esperimenti indipendenti, 24 repliche tecniche per esperimento).

Immagine a dimensione intera

MGMT (0 6 -metilguanina-DNA-metiltransferasi) è noto per essere espresso in una frazione di gliomi e per essere cruciale per la rimozione dei residui alchilici dal DNA tumorale. È stato dimostrato che è un importante meccanismo di resistenza contro i farmaci alchilanti nel GBM. È noto che il modello di metilazione del promotore possiede un significativo potere predittivo per quanto riguarda la sopravvivenza globale. L'analisi di metilazione ha rivelato uno stato completamente metilato in entrambe le linee cellulari (dati non mostrati), escludendo un ruolo di MGMT nella reazione differenziale ai farmaci alchilanti.

DISCUSSIONE

L'espressione astrocitaria di FXN era stata descritta solo occasionalmente in letteratura. 15 Poiché abbiamo osservato una riduzione della quantità di FXN nelle cellule tumorali astrocitiche, la conservazione dei normali livelli astrocitici non è essenziale per la vitalità e la proliferazione delle cellule tumorali. A prima vista, questo sembra essere in contrasto con i risultati ottenuti recentemente da Guccini et al. , 20 che hanno misurato l'espressione migliorata di FXN in una serie di GBM rispetto al tessuto cerebrale adiacente. Tuttavia, gli estratti di cervello privo di tumore utilizzati dagli autori come riferimento rappresentano una miscela di tipi di cellule. Il tessuto potrebbe inoltre essere stato influenzato da cambiamenti peritumorali, come l'edema. Poiché gli autori hanno utilizzato macchie occidentali di omogenati di tessuto, l'upregolazione di FXN non può essere chiaramente attribuita ai cambiamenti all'interno degli astrociti trasformati. D'altra parte, i confronti delle cellule di glioma con colture di astrociti proliferanti, come eseguite nel presente studio, rappresentano esclusivamente un'approssimazione artificiale della situazione in vivo . Si deve affermare che attualmente non è possibile prendere una decisione definitiva in merito ai cambiamenti di espressione negli astrociti durante lo sviluppo del tumore.

Abbiamo trovato prove per una funzione di FXN a supporto della proliferazione in condizioni ipossiche e limitate dal fattore di crescita, che possono avere un ruolo in vivo a seconda del microambiente, come la fornitura di vasi sanguigni funzionali. Guccini et al. 20 hanno dimostrato un'espressione di FXN moderatamente migliorata in vari tipi di cellule tumorali sotto ipossia, comprese le cellule di glioma U87MG (aumento di 1, 5 volte inferiore all'1% di O 2 ). Questi risultati possono essere interpretati in termini di una funzione protettiva della proteina mitocondriale in condizioni ipossiche, che è in accordo con la nostra osservazione dell'aumentata sopravvivenza dell'ipossia delle cellule U87-FXN (Figura 5b).

La maggiore sensibilità delle cellule che sovraesprimono FXN alla staurosporina induttore apoptotico e ai farmaci alchilanti punta verso un potenziale ruolo della perdita di FXN nei noti apoptosi e chemoresistenza dei tumori astrocitici. Il risultato non può essere spiegato dalla maggiore sensibilità apoptotica delle cellule trasfettate da FXN a causa del maggiore contenuto mitocondriale, poiché l'attività del CS non è stata alterata dalla trasfezione da FXN. Sia la maggiore sensibilità apoptotica che una maggiore proliferazione (come discusso di seguito) possono essere spiegate da un aumento dei livelli di ROS, misurato in cellule U87-FXN. La natura dei livelli di ROS potenziati rimane poco chiara e molto probabilmente può essere spiegata dalla riduzione osservata delle difese antiossidanti. L'aumento del ROS citoplasmatico non era certamente una conseguenza di un aumento del rilascio di H 2 O 2 da parte dei mitocondri, poiché le misurazioni nelle sospensioni mitocondriali hanno rivelato una fluorescenza ROS più bassa. FXN sembrava proteggere i mitocondri dalla generazione di ROS, come previsto dai dati della letteratura per le cellule di carcinoma. Questi risultati sono in linea con l'attività dell'aconitasi moderatamente aumentata.

A questo punto, non è chiaro se FXN regola la generazione di H 2 O 2 in siti ancora sconosciuti di cellule di glioma, o se solo una diminuzione degli enzimi disintossicanti di perossido di idrogeno catalasi e glutatione perossidasi e declino di GSH ha causato i livelli di ROS citoplasmatici migliorati in U87- Celle FXN. Indipendentemente dal meccanismo preciso, la maggiore sensibilità all'induzione della morte cellulare da parte di H 2 O 2 esterno e dalla deplezione di GSH indotta da BSO, era conforme a questi dati. Resta poco chiaro, a quali condizioni l'espressione di FXN nelle cellule eucariotiche sia upregola o downregola le difese ROS e antiossidanti.

Nel loro insieme, la sovraespressione di FXN ha prodotto risultati disomogenei in varie cellule eucariotiche. Se una funzione antiossidante della proteina, come suggerito in due modelli di carcinoma 9, 10 non è una caratteristica generale delle cellule tumorali (presente studio), non è accettabile ipotizzare che FXN agisca generalmente come un soppressore del tumore basato su queste proprietà antiossidanti, come proposto in precedenza. 10

Poiché la sovraespressione di FXN non ha indotto cambiamenti morfologici e le cellule hanno mostrato un alto tasso di proliferazione, non è probabile che l'aumento dei livelli di ROS causi "stress ossidativo" in un ambiente privo di ulteriori nox. La risposta biologica delle cellule tumorali ai ROS non è sempre dannosa, ma dipende fortemente dalla concentrazione. È noto che vari tipi di cellule tumorali, comprese le cellule di astrocitoma, aumentano la proliferazione in vitro a seguito di livelli di ROS moderatamente aumentati. 21, 22, 23 Ancora più importante, le cellule U87-FXN mostravano una crescita tumorale più rapida in vivo , mentre la soppressione ROS indotta da FXN era accompagnata da una crescita soppressa del tumore in vivo nel modello di tumore del colon-retto.

La segnalazione redox pro-proliferativa è stata a lungo discussa nella carcinogenesi, poiché diversi percorsi a valle delle tirosin-chinasi del recettore, come le protein chinasi attivate dal mitogeno , Akt e protein chinasi C (PKC) possono essere direttamente influenzati dallo stato redox intracellulare o dal redox fattore di trascrizione sensibile NFκ-B. 24 PKC può essere regolato direttamente da ROS, poiché contiene residui di cisteina, che possono subire modifiche redox indotte da ROS. 25

Nonostante gli effetti stimolanti sopra discussi di livelli di ROS moderatamente aumentati, possono allo stesso tempo sensibilizzare le cellule tumorali a fattori scatenanti apoptotici. L'apoptosi estrinseca e intrinseca (mitocondriale) può essere facilitata dal ROS. 26, 27 Le rotture del filamento di DNA e la reticolazione del filo indotta da farmaci alchilanti provocano anche apoptosi intrinseca. Non è quindi sorprendente trovare una maggiore sensibilità delle cellule U87-FXN verso i farmaci alchilanti, che è stata parzialmente salvata dagli antiossidanti. Una maggiore sensibilità alle nitrosoure di cloroetilato (come ACNU e BCNU) può inoltre essere favorita dal ridotto contenuto di GSH delle cellule che esprimono FXN, poiché GSH partecipa alla disintossicazione di questi farmaci. 28, 29, 30

Nel loro insieme, FXN può agire come un'arma a doppio taglio nei tumori astrocitici. Questo ruolo può comprendere una dannosa promozione della crescita e, d'altra parte, un benefico effetto chemosensibilizzante. Sono necessari ulteriori studi per delineare la possibile rilevanza clinica, in particolare per quanto riguarda la valutazione della chemioresistenza.