I precursori neurali derivati ​​da ipsc esercitano un ruolo neuroprotettivo nella demielinizzazione immuno-mediata attraverso la secrezione della vita | comunicazioni della natura

I precursori neurali derivati ​​da ipsc esercitano un ruolo neuroprotettivo nella demielinizzazione immuno-mediata attraverso la secrezione della vita | comunicazioni della natura

Anonim

Soggetti

  • Cellule staminali pluripotenti indotte
  • Sclerosi multipla
  • Neuroimmunologia

Astratto

La possibilità di generare cellule staminali / precursori neuronali (NPC) da cellule staminali pluripotenti indotte (iPSC) ha aperto una nuova strada di ricerca che potrebbe favorire la traduzione da banco a letto dei protocolli di trapianto di cellule nei disturbi della mielina del sistema nervoso centrale. Qui mostriamo che gli NPC derivati ​​da iPSC di topo (miPSC-NPC) - quando trapiantati per via intratecale dopo l'insorgenza della malattia - migliorano le caratteristiche cliniche e patologiche dell'encefalomielite autoimmune sperimentale, un modello animale di sclerosi multipla. I miPSC-NPC trapiantati esercitano l'effetto neuroprotettivo non attraverso la sostituzione delle cellule, ma attraverso la secrezione del fattore inibitorio della leucemia che promuove la sopravvivenza, la differenziazione e la capacità di rimielinizzazione sia dei precursori degli oligodendrociti endogeni che degli oligodendrociti maturi. La conservazione precoce dell'integrità dei tessuti limita i danni alla barriera emato-encefalica e le infiltrazioni nel sistema nervoso centrale dei leucociti encefalitogeni trasportati dal sangue, in ultima analisi responsabili della demielinizzazione e del danno assonale. Mentre proponiamo un nuovo meccanismo d'azione, i nostri risultati espandono ulteriormente il potenziale terapeutico degli NPC derivati ​​da iPSC nei disturbi della mielina.

introduzione

Lo sviluppo di terapie a base cellulare volte a promuovere la rimielinizzazione nei pazienti affetti da disturbi della mielina è stato perseguito negli ultimi 30 anni 1, 2 . Sebbene abbia avuto successo nel supportare la riparazione specifica del sito nella malattia mielinica focale 3, la maggior parte di questi approcci terapeutici basati sulle cellule non ha avuto successo nelle malattie demielinizzanti infiammatorie multifocali del sistema nervoso centrale (SNC), come la sclerosi multipla (SM).

La recente dimostrazione che le terapie basate su cellule staminali / precursori neuronali (NPC) possono promuovere la neuroprotezione nei modelli sperimentali di SM non solo attraverso la sostituzione cellulare ma anche secernendo molecole neuroprotettive - il cosiddetto effetto di astanti 4, 5, 6, 7 - ha suggerito che tali cellule potrebbero rappresentare nel prossimo futuro una fonte cellulare alternativa plausibile per la strategia terapeutica basata sulle cellule nella SM. Tuttavia, la traduzione da banco a letto delle terapie basate su NPC nella SM è ancora ostacolata dalla natura allogenica della fonte finora disponibile di NPC per le sperimentazioni sull'uomo. In effetti, sebbene siano in grado di promuovere la neuroprotezione in un modello di primati non umani di MS 8, gli NPC di origine fetale richiedono immunosoppressione concomitante quando trapiantati nell'uomo.

Cellule staminali pluripotenti indotte (iPSC) - una nuova fonte di cellule staminali pluripotenti ottenute mediante riprogrammazione genetica delle cellule somatiche 9, 10, 11 - potrebbe rappresentare la fonte autologa ideale di NPC per trapianti e scopi traslazionali nella SM. Tuttavia, sebbene la capacità delle cellule che formano mielina derivate dall'iPSC (ad esempio, OPC) di rimielinizzare topi congeniti demielinizzati è stata recentemente dimostrata 3, non si sa nulla sulla capacità di queste cellule di proteggere il tessuto neurale una volta trapiantate in un demielinizzante infiammatorio ostile ambiente come quello che caratterizza la SM.

Qui mostriamo che gli NPC derivati ​​dall'iPSC di topo (in seguito denominati miPSC-NPC) - quando trapiantati per via intratecale dopo l'insorgenza della malattia nei topi con encefalomielite autoimmune sperimentale (EAE), un modello animale di SM - migliorano le caratteristiche cliniche e patologiche della malattia. I miPSC-NPC trapiantati esercitano un effetto neuroprotettivo nell'EAE non differenziandosi in cellule produttrici di mielina ma attraverso la secrezione di una specifica neurotrofina, ovvero il fattore inibitorio della leucemia (LIF), in grado di supportare la sopravvivenza in vivo e la differenziazione degli oligodendrociti residenti. Questo effetto neuroprotettivo è, a sua volta, sufficiente per limitare il processo infiammatorio limitato al sistema nervoso centrale e l'estensione del danno tissutale.

risultati

Generazione di miPSC da fibroblasti di topo Sox2βGeo

I fibroblasti embrionali di topo (MEF) sono stati isolati da E14.5 Sox2βGeo knock-in E14.5 C57Bl / 6 Sox2 βgeo / βgeo embrioni di topo knock-in 12 e trasdotti con un vettore lentivirale che codifica per i fattori di trascrizione Oct4, Sox2 e Klf4. i miPSC derivati ​​dalla riprogrammazione dei MEF Sox2βGeo (Fig. 1a) esprimono una cassetta βgeo sotto il controllo del promotore Sox2 che conferisce resistenza cellulare alla neomicina e la capacità di essere riconosciuto dalla colorazione della galassia X (Fig. 1b). Cinque giorni dopo la trasduzione, le cellule sono state raccolte e placcate su cellule feeder MEF trattate con Mitomicina. Trenta giorni dopo, sono state osservate alcune colonie piatte e rotonde (Fig. 1a). Le colonie di miPSC sono state selezionate in base a criteri morfologici e trattate con Neomicina per selezionare le cellule che riattivano il gene endogeno Sox2 . I miPSC indifferenziati formavano colonie molto simili alle cellule staminali embrionali murine (ESC) (Fig. 1a), esprimendo il gene endogeno Sox2 (Fig. 1b). In vitro , lo stato pluripotente dei miPSC è stato validato dall'attività della fosfatasi alcalina (AP) (Fig. 1c) e dall'espressione di geni marcatori ESC non virali come Nanog , Oct4 , Sox2 , Klf4 , SSEA-1 (Fig. 1d -f, j). Inoltre, al momento della formazione di corpi embrionali (EBs), la presenza di cellule appartenenti ai tre strati embrionali è stata confermata dall'immunocolorazione per βIIITubulina (ectoderma), actina del muscolo liscio alfa (αSMA) (mesoderma) e proteina della scatola a forcella A2 (Foxa2) (endoderma ) (Fig. 1g – i). In vivo , la generazione di topi chimerici dopo l'iniezione di blastocisti (Fig. 1k) e la formazione di teratomi al trapianto di miPSC nei testicoli di topi beige SCID, hanno fornito ulteriori prove della pluripotenza dei nostri miPSC. L'esame istologico dei tumori ha rivelato la presenza di tessuti originati dai tre strati germinali (Fig. 1l-o).

Image

( a, b ) miPSC derivati ​​dalla riprogrammazione di E14.5 C57Bl / 6 Sox2 fibroblasti di topo knock-in topo2 βgeo / βgeo (fibroblasti di miPSC Sox2βgeo) ( a ) esprimono una cassetta βgeo sotto il controllo del promotore Sox2 che dà resistenza cellulare alla neomicina e la capacità di essere riconosciuto dalla colorazione X-gal ( b ). ( c - f ) Immunochimica per AP ( c ), Oct4 ( d ), Nanog ( e ) e SSEA-1 ( f ). Barra della scala, 50 micron. ( g - i ) Immunocolorazione su miPSC differenziati Sox2βgeo per βIIITubulina (ectoderma) ( g ), actina alfa dei muscoli lisci (α-SMA; mesoderma) ( h ) e proteina della scatola a forcella A2 (FOXA2; endoderma) ( i ). Barra della scala, 50 micron. ( j ) analisi PCR che mostra l'attivazione dei geni endogeni correlati alla pluripotenza: Oct4 endo 224 bp; Sox2 endo 297 bp; e Klf4 endo 711 bp. ( k ) L'iniezione di blastocisti di miPSC Sox2βgeo positivo per GFP genera topi chimerici. Barra della scala, 5 mm. ( l - o ) La colorazione di ematossilina ed eosina sul teratoma mostra strutture differenziate da tutti e tre gli strati germinali. Epitelio acerbo (ectoderma) ( l, frecce), muscolo (mesoderma) ( m, freccia), cartilagine (mesoderma) ( n, punta di freccia), ectoderma neuronale (ectoderma) ( n, freccia), ghiandole (endoderma) ( o, freccia ) .Scale bar, 1 mm.

Immagine a dimensione intera

Generazione di miPSC-NPC da mixC Sox2βGeo

Una popolazione stabile di NPC è stata derivata dai SoX2βGeo di miPSC (Fig. 2), di seguito denominati NPC miPSC, come precedentemente descritto 13 . In breve, i SoX2βGeo dei miPSC, quando placcati su supporti privi di siero, hanno generato strutture simili a rosette, il segno distintivo della differenziazione neuroepiteliale. Dopo 3-4 passaggi nel mezzo di precursori neurali, le cellule erano in grado di supportare la proliferazione di progenitori neurali e una divisione aggiuntiva ci ha permesso di purificare una popolazione omogenea aderente di NPC con una morfologia bipolare allungata tipica, piedi terminali e nuclei ovali (Fig. 2a). Le cellule sono state etichettate in vitro usando un vettore lentivirale di terza generazione che codifica per la proteina GFP. Oltre l'80% delle cellule è stato etichettato con questo metodo (Fig. 2b). L'identità delle cellule staminali neurali dei miPSC-NPC è stata confermata dall'espressione dei marcatori di cellule staminali neurali Nestin, Sox2, Olig2, Vimentin, BLBP, GLAST e Mash1 (Fig. 2c – h). Di conseguenza, i miPSC-NPC sono stati in grado di autorinnovarsi per un lungo periodo di tempo (Fig. 2i) e hanno dato origine a neuroni, astrociti e oligodendrociti quando esposti a condizioni di differenziazione (Fig. 2j – l) 14, 15, 16 . In conclusione, i NPC miPSC soddisfano tutti i requisiti degli NPC in buona fede .

Image

( a ) Immagine in campo chiaro di miPSC-NPC ottenuti da miPSC Sox2βgeo. Barra della scala, 50 micron. ( b ) espressione di GFP su miPSC-NPC dopo infezione da LV. Barra della scala, 50 micron. ( c - h ) Immunostaining per Nestin ( c ), Vimentin ( d ), Olig2 ( e ), Mash1 ( f ), Sox2 ( g ) e GLAST ( h ). Barra della scala, 50 micron. ( i ) Curva di crescita di miPSC-NPC. ( j - l ) Differenziazione di miPSC-NPC in tre popolazioni cellulari derivate da neuroni, neuroni ( j ), astrociti ( k ) e oligodendrociti ( l ). Barra della scala, 50 micron. ( m - o ) Espressione della molecola di adesione CD44 ( m ), del recettore delle chemochine CXCR4 ( n ) e dell'integrina VLA-4 ( o ) su miPSC-NPC in coltura in vitro analizzati mediante ordinamento cellulare a flusso (FACS). La linea grigia rappresenta il controllo dell'isotipo, mentre la linea rossa indica le cellule colorate.

Immagine a dimensione intera

Il trattamento miPSC-NPC promuove il recupero funzionale dei topi EAE

I miPSC-NPC sono stati trapiantati per via intratecale in topi affetti da EAE indotta da peptide 35-55 peptide oligodendrocita (MOG) al picco della malattia (17, 96 ± 1, 53 giorni dopo l'immunizzazione (dpi)). Dati i problemi di sicurezza relativi alla traduzione clinica della terapia iPSC 17, abbiamo prima analizzato sia il sistema nervoso centrale che gli organi periferici dai topi trapiantati a 3 e 6 mesi dopo l'iniezione cellulare e non abbiamo osservato né tossicità né formazione di tumori associati al trattamento con miPSC-NPC (Figura complementare S1). A 40 dpi, i topi EAE trattati con miPSC-NPC sono notevolmente migliorati rispetto ai topi trattati con sham e MEF (Fig. 3a, Fig. S2 supplementare). Inoltre, l'effetto inibitorio dei miPSC-NPC sull'EAE era specifico e non poteva essere ottenuto da altre cellule neurali in quanto non vi era alcuna differenza tra gruppi trapiantati di astrociti e gruppi trattati in modo fittizio in termini di gravità clinica (Figura complementare S2, Tabella 1) . L'effetto terapeutico dei miPSC-NPC è persistito fino alla fine del follow-up: a 80 dpi, i topi trattati con miPSC-NPC hanno raggiunto un punteggio EAE medio di 1, 0 (paralisi di coda), mentre i topi trattati con sham hanno raggiunto un punteggio medio di 2.0 (paresi dell'arto posteriore) (Fig. 3a). Il miglioramento clinico è stato accompagnato da evidenze istopatologiche della riduzione delle aree demielinizzate e del danno assonale (Fig. 3b-d). L'analisi dei geni espressi in modo differenziale (DEG) del profilo trascrizionale associato al trattamento miPSC-NPC di topi EAE ha rilevato 428 sonde espresse in modo differenziale (174 upregolate e 254 sonde downregulate rispetto al gruppo trattato con sham, Fig. 4a, cerchio destro e dati supplementari 1). È interessante notare che, tra i 428 hit correlati a miPSC-NPC, 184 (~ 43%) sono comparsi anche tra le trascrizioni relative a EAE. In particolare, su 184 sonde, 182 (50 upregulate e 132 downregulate) sono state espresse nel midollo spinale miPSC-NPC a livelli simili a quelli misurati nel midollo spinale degli animali ingenui (diagramma di Venn in Fig. 4a). Di conseguenza, il clustering gerarchico senza supervisione basato sulle 184 sonde comuni ha classificato il gruppo miPSC-NPC insieme al gruppo ingenuo (Fig. 4b), fornendo l'evidenza molecolare che gli effetti terapeutici esercitati dai miPSC-NPC trapiantati controbilanciano le modifiche trascrizionali associate all'EAE.

Image

( a ) Punteggio clinico EAE di miPSC-NPC- (punti neri) e topi trattati con sham (punti bianchi). Ogni punto rappresenta il punteggio medio della malattia di almeno 10 topi per gruppo (± sem); ANOVA a due vie; * P <0, 05; ** P <0, 01. ( b ) Quantificazione della demielinizzazione del midollo spinale e del danno assonale a 80 dpi in miPSC-NPC- (barre nere) rispetto a topi EAE trattati con sham (barre bianche) ( N = 6 per gruppo). I dati (valori medi ± sem) rappresentano la percentuale di danno. Test di studenti; * P <0, 05; ** P <0, 01. ( c, d ) Immagini rappresentative delle sezioni del midollo spinale colorate con Luxol Fast Blue ( c ) e Bielschowsky ( d ). Le linee tratteggiate rosse rappresentano le aree di danno. Barra della scala, 200 micron. ( e ) Analisi quantitativa della localizzazione di miPSC-NPC dopo trapianto in topi EAE ( N = 3). ( f - k ) Immunocolorazione per CD45, MBP, Nestin, Ki67, Olig2, GFAP, βIII tubulina e GFP mostra accumulo di cellule trapiantate (punte di freccia) all'interno di aree danneggiate del midollo spinale perivascolare. Le linee tratteggiate rappresentano le navi. I nuclei sono visualizzati con DAPI. Barre di scala, 50 micron. ( l ) percentuale (± sem) dei miPSC-NPC che esprimono i diversi marcatori di differenziazione neurale al momento del trapianto in topi EAE; la maggior parte dei NPC miPSC trapiantati è rimasta indifferenziata. ( N = 3 topi per gruppo).

Immagine a dimensione intera

Tabella a grandezza naturale

Image

( a ) Flusso di lavoro dell'analisi del trascrittoma che mostra l'espressione differenziale tra topi EAE trattati con shampoo e miPSC-NPC e topi ingenui rispetto a topi EAE trattati con sham. ( b ) Raggruppamento gerarchico di campioni senza supervisione basato su 184 ° comune ai topi EAE trattati con miPSC-NPC e contro topi ingenui rispetto a topi EAE trattati con sham. ( c ) Raggruppamento di campioni senza supervisione basato su 428 ° tra topi EAE trattati con shampoo e miPSC-NPC. ( d ) Percorsi KEGG significativamente arricchiti all'interno del profilo trascrizionale dai topi EAE trattati con shampoo rispetto a miPSC-NPC. ( e ) Processi biologici significativamente arricchiti in Gene Ontology. Il gradiente di colore che va dal giallo all'arancione indica il crescente significato statistico.

Immagine a dimensione intera

i NPC miPSC persistono indifferenziati all'interno degli infiltrati perivascolari

Per studiare ulteriormente il meccanismo a sostegno dell'effetto neuroprotettivo del trapianto di miPSC-NPC, abbiamo quindi analizzato la distribuzione tissutale dei miPSC-NPC trapiantati nei topi EAE. A 40 dpi, l'1% dei miPSC-NPC trapiantati è localizzato nell'intera neuraxis dei topi EAE e distribuito con un gradiente di concentrazione dal sito di iniezione all'estremità caudale del SNC (Fig. 3e). Le cellule trapiantate sono state trovate quasi esclusivamente attorno ai vasi subpiali dove erano visibili infiltrati infiammatori perivascolari (Fig. 3f) e danni alla mielina (Fig. 3g). La stragrande maggioranza (79%) delle cellule trapiantate ha mantenuto un fenotipo indifferenziato (morfologia rotonda) ed espresso nestin (Fig. 3f, g, l); solo una piccola parte mostrava marcatori di differenziazione neuronale e gliale - ad esempio Olig2 (2, 2%), GFAP (0, 6%), βIIITubulina (0, 3%) - e il 6% di questi proliferava (Fig. 3h– l). Abbiamo attribuito il patotropismo miPSC-NPC alle lesioni infiammatorie all'espressione costitutiva di molecole chemiotattiche come CD44, VLA-4 e CXCR4 (Fig. 2m-o), come precedentemente mostrato anche per NPC adulti 6, 7, 18, 19, 20 .

i miPSC-NPC frenano la demielinizzazione e promuovono la rimielinizzazione

Nonostante la mancanza di differenziazione delle cellule trapiantate in cellule che formano mielina, la significativa riduzione della demielinizzazione nel midollo spinale dei topi trapiantati miPSC-NPC ci ha spinto ad analizzare ulteriormente le caratteristiche cellulari delle aree danneggiate. All'interno delle lesioni demielinizzanti dei topi EAE trattati con miPSC-NPC, abbiamo trovato un numero aumentato di entrambi i proliferanti Ki67 + / Olig2 + OPC (0, 69 ± 0, 19 rispetto a 1, 48 ± 0, 22 cellule per campo) (Fig. 5a – c) e CC1 + maturo oligodendrociti (4132 ± 796, 4 contro 2027 ± 241, 9 celle mm −2 ) (Fig. 5d – f). Allo stesso tempo, abbiamo anche riscontrato una riduzione degli oligodendrociti CC1 + / Caspase3 + apoptotici maturi (Fig. 5g – i) (9, 17 ± 3, 08 rispetto al 27, 21 ± 3, 49% delle cellule).

Image

( a - c ) Quantificazione di OPC Olig2 + / Ki67 + nella colonna posteriore del midollo spinale da sham- (barra bianca) rispetto a topi EAE trattati con miPSC-NPC- (barra nera) ( a ) ( N = 6 topi per gruppo ). Immagini rappresentative da topi EAE trattati con sham- ( b ) contro miPSC-NPC- ( c ). ( d - f ) Quantificazione della densità di CC1 + oligodendrociti maturi nelle colonne posteriori del midollo spinale da sham- (barra bianca) contro miPSC-NPC- (barra nera) topi EAE trattati ( d ) ( N = 6 topi per gruppo). Immagini rappresentative da topo EAE trattato con sham- ( e ) e miPSC-NPC ( f ). ( g - i ) Quantificazione del numero di CC1 apoptotici + oligodendrociti maturi nel midollo spinale da sham- (barra bianca) rispetto a topi EAE trattati con miPSC-NPC (barra nera) ( g ) ( N = 6 topi per gruppo). Immagini rappresentative da topo EAE trattato con sham- ( h ) e miPSC-NPC ( i ). Barre di scala, 50 micron. Le punte di freccia mostrano celle a doppio positivo. I dati nei pannelli ( a, d, g ) sono espressi come media (± sem). Test di studenti; * P <0, 05; ** P <0, 01. ( j, k ) Microfotografie di elettroni che rappresentano una sezione del midollo spinale danneggiata da topi EAE trattati con sham- ( j ) e miPSC-NPC ( k ). Barra della scala, 2 μm. ( l ) Quantificazione dei rapporti g in topi EAE trattati con miPSC-NPC (nero) e sham- (rosso); i dati sono stati generati da più di 500 assoni mielinizzati per gruppo ( N = 3 topi per gruppo) e mostrano un aumento significativo delle fibre rimielinizzate nei topi trapiantati miPSC-NSC (Test di Student; P = 0, 04). ( m, n ) Quantificazione della percentuale di assoni demielinizzati ( m ) e mielinizzati ( n ) in topi EAE trattati con miPSC-NPC- (nero) e sham- (bianco) ( N = 3 topi per gruppo). I dati sono espressi come media (± sem). ( o ) Distribuzione di fibre mielinizzate in funzione del loro diametro nei topi EAE trattati con miPSC-NPC (barre nere) e sham- (barre bianche). ( N = 3 topi per gruppo). I dati sono espressi come media (± sem). ( p - r ) Immagini rappresentative dell'ibridazione in situ basata su DIG per mRNA PLP-DM20 eseguite in sezioni del midollo spinale da topi sham- ( p ) rispetto a topi EAE trattati con miPSC-NPC ( q ). Barra della scala, 100 micron. ( r ) Quantificazione del numero di cellule PLP-DM20 + nella colonna posteriore del midollo spinale da sham- (barra bianca) contro topi EAE trattati con miPSC-NPC- (barra nera) ( N = 3 topi per gruppo). I dati sono espressi come media (± sem). ( s, t ) analisi Western blot per MBP nel midollo spinale da topi EAE trattati con sham-versus miPSC-NPC; le macchie sono rappresentative di tre esperimenti indipendenti ( n ). Quantificazione dei livelli di espressione di MBP nel midollo spinale da topi EAE trattati con sham- (barre bianche) rispetto a miPSC-NPC- (barre nere) ( o ). I dati sono espressi come media (± sem). N = almeno 3 topi per gruppo. Test t di Student e test di Mann-Whitney; * P <0, 05; ** P <0, 005.

Immagine a dimensione intera

Inoltre, l'analisi ultrastrutturale ha rivelato una migliore conservazione della mielina e dell'integrità assonale (Fig. 5j, k) e un aumento significativo ( t- test P = 0, 04) degli assoni rimielinizzati in miPSC-NPC rispetto ai topi EAE trattati con sham (Fig. 5l ). Questi ultimi risultati sono stati accompagnati da una significativa riduzione degli assoni demielinizzati (Fig. 5m) e dall'aumento degli assoni mielinizzati (Fig. 5n) nei miPSC-NPC rispetto ai topi EAE trattati con sham; una scoperta non dipendente dal diametro degli assoni (Fig. 5o). Infine, sono stati riscontrati nel rachide un numero aumentato di OPP pro-mielinizzanti PLP-DM20 + (313, 7 ± 16, 79 contro 202, 5 ​​± 15, 73 cellule mm −2 ) (Fig. 5p – r) e un aumento dei livelli di proteina basale della mielina (MBP) tessuto cordonale di miPSC-NPC contro topi EAE trattati con sham (Fig. 5s, t); quindi, supportando ulteriormente un processo in corso di rimielinizzazione.

Nel loro insieme, questi risultati indicano che il trattamento con miPSC-NPC preserva non solo la vitalità, ma anche la funzionalità degli OPC e degli oligodendrociti maturi, in quanto queste cellule endogene risultarono in grado di promuovere la rimielinizzazione e la conservazione dell'integrità assonale.

L'infiammazione favorisce la protezione OPC mediata da miPSC-NPC tramite LIF

Data la propensione a mantenere un fenotipo indifferenziato al trapianto in vivo , abbiamo ipotizzato che i miPSC-NPC esercitassero l'effetto di sopravvivenza pro sugli OPC e sugli oligodendrociti maturi rilasciando molecole trofiche solubili 7, 21 . Pertanto, abbiamo esposto OPC in vitro al mezzo ottenuto da miPSC-NPC precondizionati o non in vitro con TNFα e IFNγ (Fig. 6a); queste ultime due citochine proinfiammatorie sono state usate per imitare il microambiente di tessuto infiammato in cui i miPSC-NPC trapiantati hanno esercitato le loro funzioni terapeutiche come precedentemente mostrato 6 . Dopo 5 giorni di coltura, abbiamo riscontrato un aumento significativo sia degli OPC che degli oligodendrociti maturi, come indicato dall'aumento del numero di cellule O4 + (47, 3 ± 6, 3% contro 26, 9 ± 4, 09%), cellule MBP + (17, 1 ± 1, 2% rispetto a 5, 1 ± 3, 1%) e cellule O4 + / Ki67 + (5, 3 ± 0, 7% contro 0, 3 ± 0, 2%) - in colture trattate con terreno pre-condizionato TNFα / IFNγ rispetto a colture trattate con mezzo non condizionato (Figura complementare S3a – e ). Questa scoperta ha suggerito che i miPSC-NPC, su stimoli infiammatori, secernono fattori solubili con un effetto trofico sia sugli OPC che sugli oligodendrociti maturi. Successivamente abbiamo analizzato quale molecola solubile potrebbe essere responsabile dell'effetto trofico. Tra i diversi fattori trofici testati, solo l'espressione di LIF risultava notevolmente aumentata quando i miPSC-NPC venivano sfidati con TNFα / IFNγ (Fig. 6b). Come conferma del ruolo causale di LIF, abbiamo scoperto che l'anticorpo anti-LIF è stato in grado di inibire la proliferazione di OPC (del 5, 3 ± 0, 7% contro 2, 8 ± 0, 9% di O4 + / Ki67 + ) e la differenziazione in MBP + oligodendrociti maturi (17, 1 ± 1, 2 % rispetto a 5, 7 ± 2, 1%) e per ridurre sia la OPC sia la vitalità degli oligodendrociti (47, 3 ± 6, 2% rispetto a 5, 3 ± 0, 7% delle cellule O4 + ) se aggiunti ai media miPSC-NPC TNFα / IFNγ pre-condizionati (Fig. 6c– h). Inoltre, l'effetto su OPC e oligodendrociti esercitati dal mezzo miPSC-NPC pre-condizionato con TNFα / IFNγ è stato imitato da rLIF (Fig. 6c – i). Insieme, questi dati indicano che l'infiammazione spinge i miPSC-NPC a supportare la sopravvivenza e la differenziazione di OPC e oligodendrociti attraverso la secrezione di LIF.

Image

( a ) Rappresentazione schematica del disegno sperimentale in vitro . ( b ) Analisi semi-quantitativa RT – PCR dei livelli di mRNA dei geni del fattore pro-mielinizzante espressi da miPSC-NPC precondizionati o meno con TNFα e IFNγ (ND = non rilevabile; FI = aumento della piega). ( c - e ) Quantificazione del numero totale di cellule O4 + ( c ), MBP + ( d ) e O4 + / Ki67 + ( e ) per campo microscopico. Un anticorpo neutralizzante anti-LIF (anti-LIF ab) e il LIF ricombinante (rLIF) sono stati aggiunti alle colture OPC quando indicato. I dati rappresentano la media (± sem) di tre esperimenti indipendenti rispetto alla coltura non trattata. Test di studenti; * P <0, 05; ** P <0, 01; *** P <0, 001; NS, non significativo. ( f - i ) Immagini rappresentative di OPC coltivate in mezzo non condizionato ( f ), mezzo condizionato ( g ), mezzo condizionato con anti-LIF ab ( h ) e mezzo con rLIF ( i ). Tripla colorazione per MBP (rosso), O4 (verde) e Ki67 (bianco, punte di freccia). I nuclei sono controcolorati con DAPI (blu). Barre di scala, 50 micron.

Immagine a dimensione intera

LIF esercita un effetto trofico sugli oligodendrociti endogeni

Successivamente abbiamo studiato se LIF fosse anche responsabile dell'effetto in vivo osservato sul trapianto di miPSC-NPC nei topi EAE. Abbiamo mostrato per la prima volta che i NPC miPSC trapiantati situati all'interno di infiltrati infiammatori perivascolari - e quindi rilevando l'ambiente infiammatorio - producono LIF; un risultato confermato sia a livello di proteine ​​che di mRNA tramite immunofluorescenza e ibridazione in situ (Fig. 7a, b). Quindi, abbiamo osservato un livello aumentato della forma fosforilata del trasduttore di segnale e dell'attivatore della trascrizione-3 (pSTAT3), un noto percorso LIF a valle che segnala la molecola 22, nel midollo spinale del miPSC-NPC, rispetto al trattamento simulato Topi EAE (Fig. 7c, d) e un numero aumentato di oligodendrociti CC1 + che esprimono pSTAT3 (Fig. 7e, f). Infine, i topi EAE trapiantati miPSC-NPC trattati con un'infusione intratecale continua dell'anticorpo anti-LIF neutralizzante hanno mostrato un EAE significativamente più grave (punteggio medio post-trattamento 3, 2 ± 0, 3 contro 2, 2 ± 0, 2) (Fig. 7g). È interessante notare che, sebbene il numero di infiltrati infiammatori a 30 dpi sia sovrapponibile tra i gruppi (Fig. 7h), un numero significativo di percentuale di aree demielinizzate (1, 9 ± 0, 2% rispetto a 1, 15 ± 0, 1%) (Fig. 7i), nel numero di apoptotici maturi CC1 + / Caspase3 + oligodendrociti (11, 29 ± 5, 49% contro 32, 58 ± 0, 48%) (Fig. 7j) nonché una riduzione di CC1 + oligodendrociti maturi (1.086 ± 248, 0 contro 4.398 ± 1.860 cellule mm −2 ) (Fig 7k) è stato trovato nei topi EAE trattati con iPSC-NPC più ab anti-LIF rispetto ai topi trattati solo con miPSC-NPC. Collettivamente, questi risultati indicano un'attivazione della via LIF in vivo al trapianto di miPSC-NPC e confermano che LIF è necessario per il miglioramento clinico e la conservazione della mielina indotta dal trapianto di miPSC-NPC.

Image

a ) Immunocolorazione rappresentativa per LIF e GFP di aree infiammatorie perivascolari del midollo spinale da topi EAE trattati con miPSC-NPC. I nuclei sono controcolorati con DAPI. Barra della scala, 50 micron. ( b ) immagini rappresentative dell'ibridazione in situ a base radioattiva per mRNA LIF; Le cellule LIF + si trovano vicino alle aree infiammatorie perivascolari (frecce). Nell'inserto, la co-localizzazione delle cellule che esprimono mRNA e cellule produttrici di LIF è mostrata in sezioni di tessuto adiacenti. Barre di scala, 50 micron. ( c ) Immunoblot rappresentativo che quantifica pSTAT3 e STAT3 nel midollo spinale da topi EAE trattati con sham-versus-miPSC-NPC. ( d ) Rapporto tra intensità di immunoblot di STAT3 tirosina-fosforilata (pSTAT3) rispetto a STAT3 in miPSC-NPC- (barre nere) rispetto a topi EAE trattati con sham (barre bianche) ( N = 3 topi per gruppo). I dati sono espressi come media (± sem). Test di studenti; * P <0, 05. ( e, f ) Immunocolorazione per pSTAT3 e CC1 nei topi EAE miPSC-NPC ( e ) contro sham ( f ) trattati (barra di scala, 50 μm). ( g ) punteggio EAE (media ± sem) prima e dopo il trattamento con sham (barre bianche), miPSC-NPC (barre nere), sham plus anti-LIF ab (barre grigio chiaro) e miPSC-NPCs più anti-LIF ab (barre grigio scuro). ANOVA a una via ( N = 5 per gruppo), * P <0, 05. ( h, i ) Quantificazione del numero di infiltrati infiammatori ( h ) e percentuale di danno mielinico ( i ) nel midollo spinale dei topi EAE 10 giorni dopo sham (barre bianche), miPSC-NPC (barre nere) o miPSC-NPC più trattamenti anti-LIF ab (barre di colore grigio scuro) ( N = 3 topi per gruppo). I dati sono espressi come media (± sem). Test di studenti; ** P <0, 005. ( j, k ) Quantificazione della densità di CC1 + oligodendrociti maturi ( j ) e del numero di apoptotici CC1 + / Caspase3 + oligodendrociti maturi ( k ) nelle colonne posteriori del midollo spinale dei topi EAE 10 giorni dopo sham (bianco barra), trattamenti miPSC-NPC- (barra nera) o miPSC-NPC più anti-LIF ab (barre grigio scuro) ( N = 3 topi per gruppo). I dati sono espressi come media (± sem). Test di studenti; * P <0, 05.

Immagine a dimensione intera

L'effetto trofico di miPSC-NPC limita l'infiammazione confinata al SNC

La morte di oligodendrociti che si verifica a seguito di EAE provoca la generazione di detriti di mielina parzialmente interrotti che agiscono come stimoli infiammatori endogeni in grado di esacerbare il processo infiammatorio limitato al SNC 23 . Come diretta conseguenza di questo fenomeno, la rigenerazione assonale e la rimielinizzazione sono inibite 24 e la permeabilità BBB modificata 25 . Trascrittomica e dati di annotazione funzionale — che indicano che le trascrizioni coinvolte nei processi di sopravvivenza / morte cellulare erano regolate in modo differenziato nei topi EAE trapiantati miPSC-NPC a 40 dpi (Fig. 4d, e e Dati supplementari 1) —e la riduzione osservata di oligodendrociti maturi apoptotici in topi trapiantati (Fig. 5g – i) ci hanno spinto a valutare se l'effetto neuroprotettivo esercitato dai NPC miPSC avrebbe potuto anche influenzare indirettamente la reazione neuroinfiammatoria complessiva. Abbiamo prima analizzato il carico infiammatorio nei miPSC-NPC e nei topi trattati con sham in diversi momenti dopo l'insorgenza di EAE. A 30 dpi, abbiamo scoperto che il numero e la composizione degli infiltrati infiammatori del SNC, comprese le cellule enchefalogeniche Th1 e Th17, erano simili tra i due gruppi (Figg 8a – oe 9a, c – e). Inoltre, la PCR in tempo reale che analizzava l'espressione di molecole solitamente associate a monociti / macrofagi benefici (M2) derivati ​​dal sangue 26, 27 — ovvero Arginase1, CD206, YM-1, IL4Rα e TGFβ — erano espressi in modo simile nell'intero midollo spinale cavo di topi EAE trattati con shampoo e miPSC-NPC (Fig. 8p-t).

Image

( a - e ) Citometria a flusso di cellule infiammatorie trasportate dal sangue infiltranti CNS in sham contro topi EAE trattati con miPSC-NPC a 30 dpi ( N = 4 topi per gruppo). I leucociti che si infiltrano nel SNC sono gated come CD45 hi CD11b - cellule, sottopopolazioni di cellule T come CD4 + ( a ) e CD8 + ( b ), cellule B come CD45 hi CD11b - B220 + ( c ), macrofagi (MΦ) come CD45 hi CD11b + CD11c - ( d ) e cellule dendritiche (mDC) come CD45 hi CD11b + CD11c + ( e ). Le percentuali sono state calcolate sul totale delle cellule gated CD45 (± sd). ( f - m ) grafici rappresentativi di tutte le cellule infiammatorie infiltranti il ​​SNC. I topi EAE trattati con sham sono rappresentati nei pannelli superiori ( f, h, j, l ), mentre i topi EAE trattati con miSPC-NPC nei pannelli inferiori ( g, i, k, m ). ( n ) Quantificazione delle cellule encefalitogene Th1 e Th17 derivate da topi EAE trattati con sham rispetto a miPSC-NPC a 30 dpi. Le percentuali sono state calcolate sul totale delle celle gated CD45 hi CD4 + (± sd). ( o ) Trame rappresentative della popolazione di cellule Th1 e Th17 infiltranti CNS, identificate in base alla loro produzione di IFNγ e IL-17A, rispettivamente, su topi EAE trattati con sham (a sinistra) e miPSC-NPC (a destra). ( p - t ) Analisi dell'espressione in tempo reale basata su PCR di geni di tipo M2 monociti / macrofagi nel tessuto del midollo spinale da miPSC-NPC- (barre nere) e topi trattati con sham (barre bianche) EAE ( N = 5 topi per gruppo). I risultati sono espressi come aumento della piega rispetto al livello di espressione basale nei topi trattati con sham (media ± sem).

Immagine a dimensione intera

Image

( a ) Quantificazione del numero di infiltrati infiammatori nel tessuto del midollo spinale da miPSC-NPC (barre nere) e topi EAE trattati con sham (barre bianche) a 30, 40 e 80 dpi. Le analisi vengono eseguite sulla colorazione di ematossilina ed eosina. I dati sono espressi come media (± sem). Test di studenti; * P <0, 05. ( b ) A 30 dpi, quantificazione della colorazione Luxol fast blue (demielinizzazione) e Bielschowsky (danno assonale) nel tessuto del midollo spinale da miPSC-NPC- (barre nere) rispetto a topi EAE trattati con sham (barre bianche). I dati sono espressi come media (± sem). Test t di Student ( N = 3 topi per gruppo); * P <0, 05. ( c - e ) Analisi FACS di sottopopolazioni infiltranti CNS di cellule mononucleate infiammatorie a 30 dpi nel tessuto del midollo spinale da miPSC-NPC (barre nere) e topi EAE trattati con sham (barre bianche). Le popolazioni invasori del SNC sono identificate sulla base del livello dell'espressione di CD45 e CD11b e del numero di linfociti invasori del SNC (CD45 hi CD11b - ) ( c ), cellule mieloidi (CD45 hi CD11b + ) ( d ) e microglia ( CD45b basso CD11b + ) ( e ) sono stati quantificati. La percentuale di sottopopolazione di ciascuna cellula infiltrante nel SNC viene calcolata sulle cellule totali con gate CD45 (media ± sem). ( f - k ) Analisi dell'espressione in tempo reale basata sulla PCR nel tessuto del midollo spinale da topi EAE trattati con shampoo (barre nere) e miPSC-NPC; sono rappresentati anche topi ingenui non trattati (barre grigie). I risultati sono espressi come aumento della piega rispetto al livello di espressione basale nei topi ingenui (media ± sem); Test t di Student ( N = 3 topi per gruppo); * P <0, 05, ** P <0, 005. ( l, m ) Immunocolorazione per ZO-1, CD45 e von Willebrand Factor (vWF) in topi EAE trattati con sham- ( l ) e miPSC-NPC- ( m ). Barra della scala, 50 micron. ( n - q ) Quantificazione dello stravaso di IgG nel midollo spinale di miPSC-NPC (barre nere) o sham (barre bianche) trattati con topi EAE trattati a 30 dpi ( n, o ) ea 40 dpi ( p, q ) (media ± sem). Le barre in n, p rappresentano il rapporto dell'intensità del segnale IgG misurato nelle colonne posteriori del midollo spinale rispetto a una regione arbitraria utilizzata come normalizzatore (ovvero ROI) a 30 dpi ( n ) e 40 dpi ( m ). Le barre in o, q rappresentano il rapporto tra l'intera area del midollo spinale rispetto al ROI a 30 dpi ( o ) e 40 dpi ( q ). Test t di Student ( N = 3 topi per gruppo); * P <0, 05, *** P <0, 001. ( r, s ) Immunoistochimica per lo stravaso di IgG nei topi EAE sham- ( r ) contro miPSC-NPC trattati ( i ). Le linee rosse spezzate indicano le colonne posteriori. Barra della scala, 200 micron.

Immagine a dimensione intera

Allo stesso tempo, la demielinizzazione e la perdita assonale sono state significativamente ridotte nei topi EAE trattati con miPSC-NPC (Fig. 9b). Al contrario, a 40 dpi, l'infiammazione è risultata significativamente meno pronunciata nei topi EAE trattati con shampoo (miPSC-NPC) (Fig. 9a). A 80 dpi, l'infiammazione si è attenuata in entrambi i gruppi di topi EAE (Fig. 9a).

Poiché la cinetica del carico infiammatorio nei topi EAE trapiantati era compatibile con l'ipotesi di lavoro, abbiamo ulteriormente valutato quale dei componenti infiammatori fosse coinvolto in questo processo. Ci siamo concentrati sulla BBB non solo perché un aumento della permeabilità alla BBB è un evento chiave che porta all'infiltrazione del SNC nelle cellule infiammatorie trasmesse dal sangue 28, ma anche perché l'analisi del percorso ha rivelato un arricchimento nei topi EAE trattati con sham rispetto a trapianti di trascrizioni appartenenti a due BBB- vie correlate, cioè giunzioni strette e giunzioni aderenti, e una via correlata alla migrazione del sistema nervoso centrale delle cellule mononucleari infiammatorie trasportate dal sangue, cioè la migrazione transendoteliale dei leucociti (Fig. 4d). L'analisi quantitativa RT – PCR ha confermato un ritorno ai valori basali dei livelli di mRNA della proteina 1 di adesione cellulare vascolare (VCAM1), molecola 1 di adesione piastrinica / endoteliale (PECAM1), molecola di adesione intercellulare 1 (ICAM1) e funzione linfocitaria integrina (alfa L) -antigene associato 1 (ITGAL1), Chaderin-5 dopo trapianto di miPSC-NPC in topi EAE (Fig. 9f-j). D'altra parte, il livello di espressione di ZO-1 - una molecola necessaria per sigillare il BBB e ridurre la permeabilità e lo stravaso cellulare 29 - è stato aumentato con il trattamento con miPSC-NPC rispetto al livello di base (Fig. 9k-m). Poiché tutti questi risultati hanno indicato che il trapianto di miPSC-NPC avrebbe potuto preservare l'integrità della BBB, abbiamo successivamente valutato la permeabilità della BBB. Una riduzione significativa dello stravaso di IgG è stata osservata nei topi EAE trattati con shampoo e miPSC fin dai primi 30 dpi (Fig. 9n, o); una riduzione che è stata ulteriormente aumentata a 40 dpi (Fig. 9p-s). Tutti insieme, questi risultati suggeriscono che l'effetto trofico mediato da miPSC-NPC sulla vitalità delle cellule endogene della mielina residente nel SNC, preserva la permeabilità e l'integrità del BBB e limita il continuo reclutamento del SNC di cellule infiammatorie encefalitogeniche trasportate dal sangue.

Discussione

Qui mostriamo che il trapianto di miPSC-NPC rappresenta una strategia terapeuticamente efficace nei disturbi infiammatori demielinizzanti. L'effetto terapeutico non era dovuto a un meccanismo di sostituzione cellulare 30, 31, 32, ma al rilascio in situ di molecole neuroprotettive da parte di cellule trapiantate. Abbiamo scoperto che la neuroinfiammazione che si verifica nei topi EAE era in grado di attrarre miPSC-NPC sul sito di danno mielinico e di istruire tali cellule a secernere LIF che, a sua volta, promuoveva la sopravvivenza e la funzionalità delle cellule che formano la mielina endogena. Questo meccanismo, alternativo alla sostituzione cellulare, rende i miPSC-NPC un candidato adatto per la terapia cellulare nella malattia demielinizzante infiammatoria multifocale, come la SM. Infatti, sebbene sia stato dimostrato che le cellule che formano la mielina potrebbero essere generate da iPSC 3 o riprogrammate direttamente dalle cellule somatiche 33, 34, non era noto il potenziale terapeutico di queste cellule quando trapiantate in un ambiente infiammatorio ostile di mielina, come quello caratterizzante SIGNORINA. Dato che il danno alla mielina è spesso accompagnato da infiammazione reattiva o è causato, come nel nostro contesto sperimentale, dall'infiammazione primaria, è obbligatorio trovare una popolazione di cellule staminali / progenitrici in grado di esercitare il suo effetto neuroprotettivo in un ambiente infiammatorio.

Sebbene la funzione di sopravvivenza pro di LIF non sia sorprendente in quanto vi sono diversi dati in vitro ma anche in vivo che suggeriscono che tale fattore promuove la sopravvivenza dell'OPC e degli oligodendrociti maturi attraverso una via di segnalazione intracellulare mediata da STAT3 35, 36, 37, è sorprendente che il L'effetto terapeutico mediato da miPSC-NPC è stato molto rapido ed efficace. I nostri risultati suggeriscono che questo risultato può essere attribuito a un effetto neuroprotettivo primario di LIF secreto da miPSC-NPC che porta a un effetto antinfiammatorio secondario. È un dato di fatto, l'effetto neuroprotettivo di LIF, ha indotto un danno meno pronunciato delle cellule che formano la mielina e questo è stato sufficiente per ridurre il carico infiammatorio complessivo, che è stato variamente dimostrato dipendere dalla quantità di distruzione dei tessuti 38 . La moderazione del processo infiammatorio, a sua volta, ha provocato una riduzione della perdita di BBB che alla fine ha inibito lo stravaso di CNS delle cellule mononucleate infiammatorie ematiche ematiche, 39, 40 . Se il trapianto di iPSC-NPC potrebbe favorire, direttamente o indirettamente, l'infiltrazione da parte del sistema nervoso centrale di monociti / macrofagi M2 benefici derivati ​​dal sangue (attivati ​​alternativamente) può essere previsto solo in questa fase; è interessante notare che abbiamo osservato una leggera espressione aumentata di geni correlati al lignaggio M2 nel midollo spinale di miPSC-NPC rispetto ai topi EAE trattati con sham.

Infine, non possiamo escludere che l'effetto neuroprotettivo esercitato dai miPSC-NPC potrebbe essere amplificato da altri tipi di cellule noti per secernere LIF (cioè astrociti). Inoltre, altri fattori potrebbero aver influenzato l'effetto mediato da LIF sugli oligodendrociti, poiché un effetto simile è stato recentemente osservato per il trapianto di cellule staminali mesenchimali attraverso la secrezione 41 del fattore di crescita degli epatociti.

In conclusione, sebbene proponendo un nuovo meccanismo d'azione, i nostri risultati espandono ulteriormente il potenziale terapeutico degli NPC derivati ​​dall'iPSC e suggeriscono che la conservazione dell'integrità delle cellule che formano la mielina potrebbe rappresentare una valida strategia anti-infiammatoria per promuovere la riparazione dei tessuti nei disturbi demielinizzanti immuno-mediati .

metodi

Produzione di Lentiviral Vector (LV)

In questo studio sono stati utilizzati un LV che esprimeva i geni Oct4 , Sox2 e Klf4 da un singolo cistron (chiamato riprogrammazione di LV—rep.LV) e un LV che esprimeva eGFP onnipresente (chiamato LV.eGFP). LV sono stati preparati come precedentemente descritto 42 . In breve, le cellule 293T sono state co-trasfettuate dalla precipitazione del fosfato di calcio con i seguenti quattro plasmidi: il plasmide del vettore di trasferimento (32 μg), essendo il vettore di trasferimento contenente la cassetta di espressione per i geni di riprogrammazione o il vettore di trasferimento che esprime eGFP; il plasmide di imballaggio pMD.Lg / pRRE (12, 5 μg); il plasmide di codifica dell'inviluppo pMD2.VSV-G (9 μg); (iv) pCMV-Rev (6, 25 μg). I vettori virali sono stati concentrati mediante ultra-centrifugazione e le cellule trasdotte sono state analizzate mediante FACS (FACSCalibur, Becton Dickinson Immunocytometry Systems).

Coltura di fibroblasti e generazione di miPSC

I MEF sono stati isolati dagli embrioni di topi knock-in E14.5 C57BL / 6 Sox2 βgeo / βgeo 12 . Questi topi contengono una cassetta βgeo che codifica per l'attività della β-galattosidasi (lacZ) e della resistenza G418. I fibroblasti sono stati coltivati ​​nel glucosio modificato di Dulbecco (DMEM) alto contenuto di glucosio (Euroclone), siero bovino fetale al 15% (FBS; Euroclone), L -glutamina 2 Eur (Euroclone) e penicillina / streptomicina all'1% (Invitrogen). Per la generazione di iPSC, 10 5 fibroblasti sono stati infettati dal rep.LV in DMEM 10% FBS e 4 μg ml −1 di polibrene. Dopo 1 settimana, i fibroblasti trasdotti sono stati placcati su uno strato di alimentazione di MEFs trattati con Mitomicina C (Sigma-Aldrich) (1, 2 × 10 6 cellule per piatto da 10 cm) in DMEM integrato con FBS al 15%, L -glutamina 2 mM, 0, 1 mM aminoacidi non essenziali, 1 mM di piruvato di sodio, 0, 1 mM di β-mercaptoetanolo, 5 mg ml −1 penicillina, 100 mg ml −1 streptomicina e 10 3 U ml −1 LIF (Chemicon International). Il mezzo veniva cambiato ogni giorno e le colonie iniziarono ad apparire 20 giorni dopo. Intorno al giorno 40, le colonie sono state trasferite su un nuovo strato di alimentazione Neomicina resistente e sono state selezionate colonie pluripotenti grazie alla loro resistenza al trattamento G418 (analogo della Neomicina). Successivamente, i cloni di miPSC sono stati divisi dal trattamento con tripsina ogni 2 giorni con una diluizione da 1 a 6. La pluripotenza dei miPSC è stata valutata mediante RT – PCR usando una serie di primer precedentemente descritti 13 :

4 ottobre TCTTTCCACCAGGCCCCCGGCTC TGCGGGCGGACATGGGGAGATCC (224 bp); Sox2 endo TAGAGCTAGACTCCGGGCGATGA TTGCCTTAAACAAGACCACGAAA (297 bp); Klf4 endo GCGAACTCACACAGGCGAGAAACC TCGCTTCCTCTTCCTCCGACACA (711 bp).

Colorazione AP

L'attività AP diretta è stata analizzata utilizzando il substrato blu NBT / BCIP (AP) (Roche), secondo le linee guida del produttore. La colorazione LacZ è stata eseguita su cellule in coltura dopo fissazione per 3 minuti a 4 ° C con paraformaldeide al 4% (PFA) e quindi incubata per 12 ore a 37 ° C in tampone di reazione X-Gal (PBS, ferrocianuro di potassio 35 mM, potassio 35 mM ferricianuro, 2 mM MgCl2, 0, 02% nonidet P-40 (NP-40), 0, 01% Na desossicolato) contenente 1 mg ml −1 5-bromo-4-cloro-3-indolil-β- D -galactopiranoside (X-Gal ; Sigma-Aldrich).

Differenziazione del corpo embrionale

i miPSC sono stati dissociati mediante incubazione con tripsina (Invitrogen) per 20 minuti a 37 ° C; Gli EB sono stati generati coltivando le cellule in sospensione su una capsula batterica (Sterlin) a 10 5 cellule ml −1 in terreno mES senza LIF. Dopo 3 giorni, gli EB sono stati placcati su piastre di coltura tissutale rivestite con gelatina allo 0, 1% (Sigma-Aldrich) e le cellule sono state analizzate 4 giorni dopo.

Generazione di Chimera

Dopo l'iniezione di 8–10 miPSC Sox2βGeo in ciascuna blastocisti E3.5 isolata da topi C57Bl / 6, le blastocisti sono state trasferite in femmine CD1 pseudo-gravidanza E2.5 e le chimere sono state analizzate al giorno embrionale 13-14 dalla fluorescenza GFP.

Formazione di teratoma

I topi beige SCID sono stati anestetizzati con 140 ml di soluzione anestetica contenente il 12, 5% di ketamina e il 6, 25% di xilazina in soluzione salina allo 0, 9% prima di iniziare l'intervento chirurgico. I testicoli sono stati esposti e 1 × 10 6 miPSC risospesi in 10 ml di PBS sono stati iniettati nel testicolo destro. Il tasso di successo della generazione di teratoma era del 100% e dopo 6 settimane i topi furono uccisi. I tumori sono stati rimossi ed elaborati per microscopia ottica. Le sezioni di tessuto incluse in paraffina sono state colorate per ematossilina ed eosina.

Derivazione e cultura dei miPSC-NPC

I miPSC-NPC sono stati ottenuti dai miPSC Sox2βgeo seguendo il protocollo pubblicato 13 . miPSC-NPC sono stati coltivati ​​in adesione nel mezzo di proliferazione di NPC: mezzo Euromed-N (Euroclone), supplemento di N 2 (Invitrogen), 20 ng ml −1 EGF (Peprotech Inc.) e 20 ng ml −1 FGF-2 (Peprotech Inc .). Per il passaggio di routine, i miPCC-NPC sono stati dissociati in sospensione a singola cellula con Acutasi (Sigma) e divisi 1: 4 o 1: 5 ogni 2-3 giorni.

Differenziazione di miPSC-NPC

i miPSC-NPC sono stati differenziati in astrociti, neuroni e oligodendrociti come precedentemente descritto 13, 15, 16 . In breve, gli astrociti sono stati ottenuti aggiungendo il 5% di FBS alla coltura media. Per la differenziazione neurale, i NPC miPSC sono stati esposti a B27, quindi placcati su vetrini di vetro rivestiti di laminina in presenza di concentrazioni decrescenti di FGF-2 aggiungendo gradualmente fattore neurotrofico derivato dal cervello fino a 30 ng ml −1 in 10-15 giorni . Per ottenere gli oligodendrociti, i miPSC-NPC sono stati placcati su vetrini di vetro pretrattati con poliornitina e laminina. La differenziazione degli oligodendrociti ha richiesto uno stadio precursore gliale intermedio, supportato dal fattore di crescita derivato dalle piastrine (PDGF) α e dal mitogeno forskolina, seguito dal ritiro del fattore di crescita e dall'aggiunta di triiodotironina (T3) e acido ascorbico (AA) per 1 settimana per promuovere il terminale differentiation into the oligodendrocyte lineage.

EAE induction

Chronic-relapsing EAE was induced in 6–8 weeks C57Bl/6 female mice (Charls River) by subcutaneous immunization with MOG 35–55 peptide (200 μg per mouse) in incomplete Freund's adjuvant containing 8 mg ml −1 Mycobacterium tuberculosis (strain H37Ra; Difco). Mice were iv injected with 500 ng of pertussis toxin (Sigma) the day of the immunization and 2 days later. Body weight and clinical score (0=healthy; 1=limp tail; 2=ataxia and/or paresis of hindlimbs; 3=paralysis of hindlimbs and/or paresis of forelimbs; 4=tetraparalysis; 5=death) was recorded daily 6 .

All procedures involving animals were performed according to the guidelines of the Animal Ethical Committee of our Institute (IACUC).

miPSC-NPC transplantation

Six to eight weeks C57Bl/6 female mice (Charls River) were anaesthetized with 12.5% ketamine and 6.25% xylazine in 0.9% saline solution. miPSC-NPCs, murine fibroblasts and murine astrocytes (1 × 10 6 cells per mouse diluted in 10 μl) were transplanted by stereotaxic injection into cisterna magna of EAE mice at the peak of the disease (4 days after disease onset). Age- and sex-matched sham (PBS)-treated EAE mice were sued as controls. MEFs were obtained by C57Bl/6 mouse pups as described above, while mouse primary astrocytes were prepared from newborn mice following published procedures 43 . Briefly, forebrains were collected from newborn C57Bl/6 mouse pups and carefully freed of meninges, chopped into 0.25-mm sections and dissociated by a mild trypsinization procedure and gentle mechanical disruption with a Pasteur pipette. The cells were seeded into poly- L -lysine (10 μg ml −1 )-coated 175-cm 2 flasks at the density of 4 × 10 4 cells cm −2 and grown at 37 °C in a 92% air–8% CO 2 humidified atmosphere in DMEM (Invitrogen) containing 0.45-μm filtered, 10% FBS (Invitrogen), 2 mM glutamine (BioWhittaker, Verviers, Belgium), penicillin (100 U ml −1 ) and streptomycin (100 μg ml −1 ). The medium was replaced after 24 h and then every 3 days. After about 10 days in vitro , primary cultures were vigorously shaken to detach microglia and oligodendrocytes growing on top of the astrocytic layer. The remaining adherent cells were detached with trypsin (0.25%)/EDTA, resuspended in fresh medium and reseeded on poly- L -lysine-coated plastic surfaces. Purity of mouse astrocyte cultures was checked by GFAP staining and was >95%. At the time of killing—which occurred at different time points after immunization (30, 40 and 80 dpi)—at least 10 mice per group were anaesthetized and transcardially perfused with saline solution followed by 4% PFA. Brains, spinal cords and peripheral organs (heart, lungs, liver, spleen, gut and kidney) were removed and processed for light and electron microscopy.

LIF neutralization in EAE mice

Subcutaneous osmotic minipumps (ALZET, model 1007) were implanted in EAE mice after sham or miPSC-NPC treatment. Two microgram per day of LIF neutralizing antibody (R&D) were dissolved in PBS and administered for 7 days intracerebroventricularly to EAE mice using a brain catheter (Brain Infusion Kit 3, ALZET) connected to the subcutaneously implanted osmotic minipump. Stereotaxic apparatus was used to determine the exact location of the brain catheter inside the lateral ventricle (from bregma, 0.3 mm anterior, 0.8 lateral).

Neuropathological analysis

Paraffin-embedded tissue sections were stained for hematoxylin and eosin, Luxol fast blue and Bielshowsky silver impregnation to detect inflammatory infiltrates, demyelination and axonal loss, respectively. The number of perivascular inflammatory infiltrates was calculated as the mean number of inflammatory infiltrates per spinal cord section. Six animals per group were analysed. For analysis of demyelination and axonal damage, paraffin-embedded, adjacent serial transverse spinal cord sections (5 μm) were stained with Luxol fast blue/periodic-acid Schiff staining and Bielschowsky silver impregnation. Tissue damage was marked with ImageJ and expressed as the percentage of damage area on the entire spinal cord section. At least 5 animals per group (miPSC-NPCs and Sham) were analysed and 12 to 20 different rostro-caudal sections were marked per animal. Statistical significance was assessed by unpaired Student's t -test.

Immunofluorescenza e immunoistochimica

Cells in culture and tissues (20 μm) were fixed with 4% PFA in phosphate buffer solution (PBS) pH 7.2 and tissues were cryoprotected for at least 24 h in 30% Sucrose (Sigma) in PBS at +4 °C. Coronal brain and spinal cord sections (20 μm) and fixed cells were incubated with blocking solution (PBS 1x, FBS 10%, BSA 1 mg ml −1 and Triton 0.1%) for 1 h and then primary antibodies were applied in the same solution over night at +4 °C. The following primary antibodies were used: mouse α-OCT4 (1:50, Santa Cruz Biotechnology); rabbit α-Nanog (1:200, Millipore); mouse α-SSEA3 (1:150, Millipore); Foxa2; αSMA; mouse α-Vimentin (1:200, Abcam); rabbit α-Mash1 (1:200, Chemicon); GLAST; rabbit α-Sox2 (1:100, Millipore); α-Ki67 (1:1, 000, Novocastra); rabbit α-TuJ1 (1:1, 000, Covance); rabbit α-Olig2 (1:200, Chemicon); mouse α-Olig2 (1:300, Chemicon); mouse α-GFAP (1:1, 000, Chemicon); rabbit α-GFAP (1:1, 500, Dako); mouse α-O4 (1:100, Millipore); rabbit α-NG2 (1:200, Santa Cruz); mouse α-Nestin (1:100, BD Pharmagen); chicken α-GFP (1:300, Abcam); rabbit α-pSTAT3 (1:200, Cell Signalling); rabbit α-STAT3 (1:200, Cell Signalling); rat α-MBP (1:200, Chemicon); goat α-LIF (1:50, R&D); mouse α-APC (1:100, Calbiochem); mouse α-ZO-1 (1:150, ); rabbit α-von Willebrand Factor (1:1000, Abcam); rat α-CD45 (1:100, BD Pharmagen); rabbit α-caspase3 clived (1:200, Cell Signalling). Appropriate fluorophore-conjugated secondary antibodies (Alexa Fluor 488, 546, 405 and 633, Molecular Probes) or alternatively the chromogen DAB (Vector Laboratories) were used for detection accordingly manufacturer's instructions. Omission of the primary antibodies showed no specific staining. Nuclei were stained with 4′, 6-diamidino-2-phenylindole (DAPI, Roche). Immunopositive cells within lesions were counted once the extent of the demyelination had been established with Luxol fast blue staining on adjacent sections. Microscopy was performed using Light (Olympus, BX51 equipped with × 4 and × 20 objectives) and confocal (Leica, SP5 equipped with × 20 and × 40 objectives) and images were analysed by using Leica LCS lite and Adobe Photoshop CS software (Adobe Systems Incorporated, CA 95110, USA).

ibridazione in situ

Radioactive and DIG in situ hybridization were performed as follows 44 . Briefly, radioactive in situ hybridization was performed on 20 μm-thick spinal cord sections post-fixed 15 min in 4% PFA, washed three times in PBS and incubated in 0.5 mg ml −1 of Proteinase K (Roche) in 100 mM Tris-HCl (pH 8), 50 mM EDTA for 10 min at 30 °C. After a second 15 min fixation was done in 4% PFA, slices were then washed three times in PBS, once in H 2 O and then incubated in triethanolamine (Merk) 0.1 M (pH 8) for 5 min. Four hundred microlitre of acetic anhydride (Sigma) was added twice for 5 min. Finally, sections were rinsed in H2O for 2 min and air-dried. Hybridization was performed overnight at 60 °C with α-UTP-P33 (GE) LIF riboprobe at a concentration ranging from 10 6 to 10 7 counts per minute (cpm). The day after, sections were rinsed in SSC 5X for 5 min then washed in formamide 50% (Sigma)-SSC 2X for 30 min at 60 °C. Slides were then incubated in ribonuclease-A (Roche) 20 mg ml −1 in 0.5 M NaCl, 10 mM Tris-HCl (pH 8), 5 mM EDTA 30 min at 37 °C, then washed in formamide 50% SSC 2X for 30 min at 60 °C and rinsed two times in SSC 2X. Finally, slides were dried using ethanol series. Lm1 (GE Healthcare Life Sciences, Milan, Italy) emulsion was applied in dark room, according manufacturer's instructions. After 1 week, sections were developed in dark room, counterstained with DAPI and mounted with DPX (BDH) mounting solution.

DIG in situ hybridization was performed as described for radioactive one. In details, PLP-DM20 riboprobe was synthesized using DIG RNA Labeling Mix (Roche). Hybridization was performed overnight at 60 °C with Digriboprobes. After last SSC 2X wash, slices were incubated in Tris-HCl 2 M, NaCl 5 M for 1 h at room temperature. Primary antibody α-Dig-POD (α-Dig conjugated with horse-radish peroxidase; 1:2, 000, Roche) was added and incubated overnight at 4 °C. Sections were then washed with 0.1 M Tris-HCl pH=9.5, 0, 1 M NaCl, 50 mM MgCl 2 and subjected to BCIP (5-bromo-4-chloro-3-indolyl-phosphate)/NBT (nitro blue tetrazolium) for the colorimetric detection.

PLP-DM20 riboprobe was kindly provided by Robin Franklin (Cambridge, UK) and LIF riboprobe was PCR generated based on NCBI Reference Sequence NM_001039537. Microphotographs of sections were digitalized in dark field light microscopy (Olympus BX51, and × 4 objective) by using a CCD camera (Leica). Images were analysed by using Adobe Photoshop CS. To confirm the specificity of the different RNA probes, sense strand RNA probes (showing no signal) were used as negative controls.

Microscopio elettronico

Mice were perfused as described above. Spinal cord tissue was removed and fixed with 2% (vol/vol) glutaraldehyde in 0.12 M phosphate buffer, post-fixed with 1% (wt/vol) osmium tetroxide and embedded in Epon (Fluka). Semithin (1 μm thick) and ultrathin (70–80 nm thick) sections were cut from the spinal cord. Semithin sections were stained with toluidine blue. For electron microscopy, ultrathin sections were stained with uranyl acetate and lead citrate and examined by electron microscopy (Leo 912 Omega) using a × 100 objective 45 . The percentage and the number of myelinated/demyelinated axons and G ratio measurements were performed on digitized non overlapping electron micrographs images. G ratios were determined by dividing the mean diameter of an axon without myelin by the mean diameter of the same axon with myelin. To determine the size distribution of myelinated fibres in the spinal cord, diameters of all fibres in at least 10 randomly chosen representative images were measured and binned based on their width. The number of myelinated and nonmyelinated axons were counted in at least ten randomly chosen representative images. All measurements were acquired on × 100 semithin section images.

immunoblotting

Spinal cord tissue was collected from at least three saline perfused EAE mice per group and homogenized in a lysis buffer containing 2% SDS, 95 mM NaCl, 10 mM EDTA, 1 mM PMSF, 10 μg ml −1 aprotinin, 20 μM leupeptin, 1 mM orthovanadate and 2.5 mM sodium pyrophosphate in 25 mM Tris buffer (pH 7.4). Protein concentrations were determined by the BCA method (Pierce) 46 . Ten to 20 μg of protein for samples were fractionated by SDS–PAGE and blotted onto nitrocellulose (Protran Biosciences). After blocking in 4% milk in TBST (0.1% Triton X-100 in TBS), appropriate regions were incubated with specific primary antibody prepared in 5% BSA, 0.05% sodium azide in TBST and secondary antibodies and developed with the ECL western blotting Detection Reagent (GE Healthcare). Semi-quantitative western blot analysis was performed using ImageJ software. Raw data are shown in Supplementary Fig. S4. Antibodies: mouse monoclonal α-MBP (SMI-94, SMI-99); rabbit α-phospho-STAT3 (1:200, Cell Signalling); rabbit α-STAT3 (1:200, Cell Signalling).

OPC culture

In our in vitro studies we used rat oligodendrocyte precursors following the myelinating oligodendrocyte coculture system developed by Chan et al . 47 This is a well established and used system that allows the preparation of a significant amount of pure OPCs. We purposely used rat oligodendrocytes in order to obtain enough pure cells for performing all the in vitro experiments. Thus, to avoid possible effects due to species' differences, we have tested the effects of LIF and conditioned media also on rat OPCs prepared by differential immunopanning. Primary OPCs from P1 Sprague–Dawley rat cortices were grown over an astrocyte monolayer in DMEM, 10% FBS (Invitrogen). After 10 days, OPCs were separated by orbital shaking and immunopanned using anti Ran-2 and A2B5 (refs 47, 48). Fifty thousand A2B5 + OPCs were plated on poly-lysin coated glass coverslips and kept in DMEM containing 10% FBS. The following day, medium was changed to SATO medium supplemented with proliferating (10 ng ml −1 FGF and 10 ng ml −1 PDGFα) or differentiating (30 ng ml −1 T3) growth factors or to conditioned SATO medium. Conditioned medium was obtained by the culture of 1 × 10 6 miPSC-NPCs in 5 ml of SATO for 24 h with or without inflammatory cytokines (10 ng ml −1 IFNγ and 15 ng ml −1 TNFα). For LIF neutralization, supernatant of miPSC-NPCs cultured with or without inflammatory cytokines was harvested at 24 h from miPSC-NPC cultures and supplemented with LIF neutralizing antibody (R&D) (0.5 μg ml −1 ). Recombinant LIF (rLIF) (1 ng ml −1 ) was added to SATO medium as positive control. At least four coverslips were subjected to each culture condition and three biological replicate were performed. In this culturing condition, differentiation of OPCs was quantified by counting the number of MBP + (that is, mature oligodendrocytes), O4 + (that is, OPCs and oligodendrocytes), and O4 + /Ki67 + (that is, OPCs) cells in at least 10 fields per the coverslip.

RNA extraction and RT–PCR

Total RNA was extracted from the spinal cord of minimum five mice per group and from cells using Trizol reagent (Invitrogen) and residual DNA was removed by treatment with 1 U DNase per 1 mg RNA (RQ1 RNase-free DNase, Promega) at 37 °C for 30 min according to manufacturer's procedures. cDNA synthesis was performed by using ThermoScriptTM RT–PCR System (Invitrogen) and Random Hexamer (Invitrogen). mRNA levels were measured by real-time RT–PCR (Applied Biosystem, Invitrogen). The 2− ΔΔCT method was used to calculate relative changes in gene expression 49 . The following Applied Biosystem (Invitrogen) probes were used: LIF (Mm00434761_m1), FGF-2 (Mm00433287_m1), PDGF (Mm00833533_m1), CNTF (Mm00446373_m1), TGFβ (Mm03024053_m1), Noggin (Mm00476456_s1), BMP4 (Mm00432087_m1), Chaderin-5 (Cdh5) (Mm00486938_m1), ICAM (Mm00476227_m1), VCAM1 (Mm00449197_m1), PECAM1 (Mm01242584_m1), ITGAL (Mm00801807_m1), ZO-1 (Mm01320637_m1), Pten (Mm1212532_m1), IL4ra (Mm01275139_m1), YM-1 (Mm00657889_m1), CD206 (Mm00485148_m1), and Arg1 (Mm00475988_m1).

Isolation of CNS-infiltrating mononuclear cells

Ten days after the treatment, EAE mice were intracardially perfused with cold HBSS and spinal cords and hindbrains were collected. Tissues were homogenized with neural tissue dissociation kit according to the manufacturer's procedures (Miltenyi Biotech). CNS-infiltrating mononuclear cells were isolated from discontinuous 30%:70% Percoll gradient 50 . Briefly, the homogenate was resuspended in 30% Percoll (Pharmacia, Piscataway, NJ), and underlaid with 70% Percoll. The gradients were centrifuged at 2, 400 g at 24 °C for 20 min. CNS mononuclear cells were collected from the Percoll interface, washed and resuspended in FACS buffer (phenol red negative Hank's BSS with 10% FBS) for further analysis.

Flow-activated cytometric analysis

For surface staining, CNS-infiltrating cells isolated form EAE mice or miPSC-NPCs were incubated with 5% fetal calf serum, 2% rat serum and 2.5 μg ml −1 rat anti-mouse Fc III/II receptor (CD16/CD32) blocking antibodies (BD Pharmingen) for 10 min at 4 °C and then stained for 30 min at 4 °C with the following directly conjugated monoclonal primary antibodies specific for mouse antigens: CD4 (RM4-5), CD11b (M1/70), CD11c (N418), CD45.2 (104), CD8 (Ly-2), CD45R/B220 (RA3-6B2), CD44 (IM/7) (BD Pharmingen), VLA-4 (PS/2; Abcam), CXCR4 (2B11; eBioscience). As negative control, we used florescence mix minus one colour for multiple staining and the corresponding isotype control for single staining. For intracellular cytokine staining, cells were stimulated for 6 h with phorbol 12-myristate 13-acetate (50 ng ml −1 ) and ionomycin (500 ng ml −1 ) in the presence of GolgiPlug (BD Pharmingen). Then, cells were stained for surface molecules, fixed and made permeable with a Cytofix/Cytoperm Plus kit (BD Bioscience) and stained with the following antibodies: IL-17A (TC11-18H10) and IFN-γ (XMG1.2) (all from BD Pharmingen). The cells were washed and analysed. Data were acquired with a Canto II flow cytometer (Becton Dickinson) and analyses were performed with DIVA or FCS Express V3 software.

Analisi di microarray

Three mice per group (naive, miPSC-NPC-treated or sham-treated), at 40 dpi, were anaesthetized and transcardially perfused with RNase-free 0.9% saline containing 10 U ml −1 of heparin at 40 dpi. CNS was collected, and brain and spinal cord of each animal were separately homogenized in 1 ml of QIAzol Lysis Reagent (Qiagen, Valencia, CA, USA, #79306) using a rotor-stator homogenizer. RNA was extracted according to manufacturer instructions and their concentration was determined spectrophotometrically by A260 (Nanodrop-ND 1000, Nanodrop, Wilmington, DE, USA). cRNA amplification was performed using the Illumina TotalPrep RNA Amplification Kit (Ambion) and 1.5 μg of biotin-labelled cRNA of each sample was hybridized on Illumina MouseWG-6 v2 expression bead chip (Illumina). The array contained 45281 probes representing transcripts contained in the NCBI-Refseq, Riken, and Meebo databases. The raw data were background subtracted and cubic spine normalized using Illumina GenomeStudio software. Detection P -values reported by the GenomeStudio were used to estimate the amount of detected probes 51, and a threshold of detection P -value<0.05 was applied for filtering. No outlier samples were found in principal component analysis and hierarchical sample clustering. Differential gene expression analysis were performed in the R-bioconductor platform and the empirical Bayes test was used as implemented in the LIMMA package 52 . DEG passed P -value<0.01 and ±1.7 fold change thresholds and were used for bioinformatical functional annotation. Pathway and Gene Onotology enrichment analyses were performed using the Genecodis tool 53, with the enrichment criteria of at least three genes in one category and P -value<0.05, computed from χ 2 -test followed by Benjamini–Hochberg's correction.

analisi statistica

Statistical evaluations of RT–PCR data, immunoblot data, FACS data, EAE score and immunohistochemical analyses results were expressed as mean±sem Results were analysed using the unpaired Student's t -test and two-way ANOVA for clinical score analysis. Mann–Whitney test was used when non parametric data have been compared and analysed. Analyses were performed using the Prism V5.0a software (Graph-Pad, San Diego, CA, USA). Statistical significance was accepted when * P <0.05, ** P <0.01, *** P <0.001.

Informazioni aggiuntive

Accession codes: The MIAME-compliant microarray data have been deposited in the EBI ArrayExpress database under accession number E- MTAB-1546.

How to cite this article: Laterza, C. et al . iPSC-derived neural precursors exert a neuroprotective role in immune-mediated demyelination via the secretion of LIF. Nat. Commun. 4:2597 doi: 10.1038/ncomms3597 (2013).

adesioni

ArrayExpress

  • E- MTAB-1546

Informazione supplementare

File PDF

  1. 1.

    Figure supplementari

    Figure supplementari S1-S4

File Excel

  1. 1.

    Dati supplementari 1

    Repertoire of differentially expressed transcripts in spinal cords of miPSC-NPC vs. sham-treated EAE mice

Commenti

Inviando un commento, accetti di rispettare i nostri Termini e le Norme della community. Se trovi qualcosa di offensivo o non conforme ai nostri termini o linee guida, segnalalo come inappropriato.