Tmprss2: fusione genica erg associata a carcinoma prostatico letale in una vigile coorte di attesa | oncogene

Tmprss2: fusione genica erg associata a carcinoma prostatico letale in una vigile coorte di attesa | oncogene

Anonim
  • Un errore di questo articolo è stato pubblicato il 16 agosto 2007

Astratto

L'identificazione del TMPRSS2: fusione ERG nel carcinoma prostatico suggerisce che diversi sottotipi molecolari possono definire il rischio di progressione della malattia. In serie chirurgiche, TMPRSS2: la fusione ERG è stata identificata nel 50% dei tumori. Qui, riportiamo su una coorte basata sulla popolazione di uomini con carcinoma prostatico localizzato seguito da terapia in attesa (vigile attesa) con il 15% (17/111) TMPRSS2: fusione ERG . Abbiamo identificato un'associazione statisticamente significativa tra TMPRSS2: fusione ERG e morte specifica per carcinoma prostatico (rapporto di incidenza cumulativo = 2, 7, P <0, 01, intervallo di confidenza al 95% = 1, 3-5, 8). La reazione a catena quantitativa di trascrizione inversa-polimerasi ha dimostrato che un'espressione di geni ad alta regolazione estrogenica (ERG) da associare a TMPRSS2: fusione di ERG ( P <0, 005). Questi dati suggeriscono che TMPRSS2: i tumori della prostata da fusione ERG possono avere un fenotipo più aggressivo, probabilmente mediato dall'aumentata espressione di ERG.

Principale

Alla diagnosi iniziale, il 91% dei 234 460 uomini con carcinoma prostatico identificati negli Stati Uniti nel 2006 presenterà una malattia clinicamente localizzata con un tasso di sopravvivenza a 5 anni del 100% (Jemal et al., 2006). Le attuali opzioni di trattamento per il carcinoma prostatico localizzato comprendono: prostatectomia radicale, radioterapia o terapia in attesa (vigile attesa). Dato l'eccellente risultato a breve termine indipendentemente dal trattamento, i rischi della terapia devono essere bilanciati con il rischio di progressione della malattia. Uno studio randomizzato ha valutato il beneficio della prostatectomia radicale rispetto alla terapia in attesa. Lo studio n. 4 del Scandinavian Prostate Cancer Group ha dimostrato che la chirurgia ha ridotto significativamente il rischio di morte per cancro alla prostata (Holmberg et al., 2002; Bill-Axelson et al., 2005). Tuttavia, per prevenire una morte specifica per carcinoma prostatico, 19 uomini sono sottoposti a trattamento e alcuni uomini sono morti nonostante la chirurgia radicale. Warlick et al. (2006) hanno riferito che dopo aver definito un gruppo a rischio minimo utilizzando parametri patologici e clinici, la terapia in attesa non era associata ad un aumento della progressione della malattia quando alla fine è stato somministrato il trattamento definitivo. Pertanto, l'accettazione della futura terapia dipende dall'accurata valutazione del rischio per la progressione della malattia del cancro alla prostata. L'identificazione del TMPRSS2: fusione ETS nel carcinoma prostatico suggerisce che distinti sottotipi molecolari possono ulteriormente definire il rischio di progressione della malattia (Tomlins et al., 2005; Soller et al., 2006). La fusione genica più comune è TMPRSS2: ERG trovato in circa il 50% delle coorti su base chirurgica studiate fino ad oggi.

Nei primi studi, le fusioni geniche della regione non tradotta 5′ di TMPRSS2 (21q22.3) con i membri della famiglia del fattore di trascrizione ETS , il gene regolato dagli estrogeni ( ERG ) (21q22.2), ETV1 (7p21.2) (Tomlins et al., 2005) o ETV4 (Tomlins et al., 2006) forniscono un meccanismo per la sovraespressione dei geni ETS nei tumori della prostata. Inoltre, la fusione di un gene regolato dagli androgeni, TMPRSS2 e un oncogene suggerisce che la progressione della malattia può variare in base a questi sottotipi molecolari. Un meccanismo comune per la fusione genica è la perdita di 2, 8 Mb di DNA genomico tra TMPRSS2 ed ERG (Perner et al., 2006) (Figura 1a eb). Nel presente studio, caratterizziamo una coorte basata sulla popolazione rispetto alla fusione di TMPRSS2: ERG ed esploriamo il rischio di metastasi o morte specifica del carcinoma prostatico in base alla presenza della comune fusione di TMPRSS2: ERG .

Image

( a - c ). Il saggio FISH rileva il caratteristico modello di ibridazione associato a TMPRSS2: fusione genica ERG , che è associata alla progressione della malattia. ( aeb ) Utilizzando questo sistema di sonde FISH multicolore, un nucleo senza riarrangiamento ERG mostra due coppie di segnali rossi e verdi giustapposti. I segnali rosso-verdi giustapposti a volte formano un segnale di fusione giallo ( b, freccia). Un nucleo con un riarrangiamento ERG mostra la sostituzione di una coppia di segnali rosso-verde giustapposta con un singolo segnale rosso per l'allele traslocato ( b ). Questo modello di ibridazione è coerente con una cancellazione di ∼ 2, 8 Mb di DNA genomico che comprende la porzione telomerica della sonda ERG . ( c ) In un modello di regressione cumulativa dell'incidenza, abbiamo valutato TMPRSS2: ERG come determinante per l'incidenza cumulativa o metastasi o morte specifica per carcinoma prostatico. Abbiamo osservato una differenza significativa nella sopravvivenza a favore di TMPRSS2: casi negativi di fusione genica ERG . CIR (CIR = 2, 7, P <0, 01, IC 95% = 1, 3-5, 8) è stato eseguito utilizzando l'equazione di stima ponderata implementata nella libreria R cmprsk (R Development Core Team, 2006). Altre analisi statistiche sono state eseguite utilizzando SPSS 13.0 per Windows (SPSS Inc., Chicago, IL, USA).

Immagine a dimensione intera

La coorte di Watchful Waiting è stata precedentemente descritta e i dettagli possono essere trovati nel materiale Supplementare (Johansson et al., 1989, 1992, 1997, 2004; Andren et al., 2006). In breve, la coorte comprende 252 uomini con carcinoma prostatico precoce (T1a-b, Nx, M0) diagnosticati mediante resezione transuretrale della prostata o enucleazione transenicale dell'adenoma per iperplasia prostatica benigna sintomatica presso l'Ospedale universitario di Örebro, Svezia tra il 1977 e il 1991. Baseline la valutazione alla diagnosi comprendeva esame fisico, radiografia del torace, scansione ossea e radiografia scheletrica (se necessario). I pazienti sono stati seguiti in maniera attesa (senza trattamento curativo) e hanno ricevuto esami clinici, test di laboratorio e scansioni ossee ogni 6 mesi durante i primi 2 anni dopo la diagnosi e successivamente a intervalli di 12 mesi. La progressione della malattia sintomatica è stata trattata con terapia di deprivazione androgenica o radioterapia palliativa.

I pazienti sono stati seguiti fino alla morte per cancro alla prostata, o censurati al momento di un'altra morte o fino alla fine del periodo di osservazione nell'ottobre 2005. Nessun paziente è stato perso per il follow-up. L'end point del presente studio era il carcinoma della prostata letale, definito come sviluppo di metastasi a distanza o carcinoma della prostata come causa di morte alla base (tempo di follow-up mediano 9, 1 anni, massimo 28 anni).

Tutte le resezioni transuretrale dei campioni di prostata (TURP) sono state esaminate da un patologo per confermare una diagnosi di cancro alla prostata, determinare il punteggio di Gleason e il grado nucleare e stimare il carico tumorale come precedentemente descritto (Andren et al., 2006). Questo lavoro è stato eseguito prima della valutazione dei dati molecolari. Un microarray di tessuti è stato assemblato usando un arrayer manuale (Rubin et al., 2005). La frequenza del TMPRSS2: riarrangiamento ERG nel carcinoma della prostata è stata valutata utilizzando un test di ibridazione in situ a fluorescenza (FISH) (Perner et al., 2006). Questo test FISH è un test indiretto e pertanto non può confermare direttamente la fusione di TMPRSS2: ERG (vedere i materiali supplementari per i dettagli). Tuttavia, come precedentemente riportato (Tomlins et al., 2005), l'analisi rapida dell'amplificazione mediata da ligasi 5 ′ dell'RNA delle estremità del cDNA (RLM-RACE) e il sequenziamento del prodotto di reazione a catena della polimerasi inversa-trascrizione (RT-PCR) da i casi di carcinoma della prostata con ERG sull'espressione hanno rivelato una fusione di TMPRSS2 con ERG mediante PCR quantitativa (QPCR) e / o RACE. Ciò dimostra che quasi tutti i campioni di cancro alla prostata con marcata sovraespressione di ERG hanno un riarrangiamento e la sovraespressione si verifica in circa lo stesso numero di casi del riarrangiamento.

Abbiamo caratterizzato 111 casi per TMPRSS2: fusione ERG . Novantadue dei casi erano caratterizzati da FISH (Figura 1a eb), mentre 19, per i quali FISH falliva, erano caratterizzati da QPCR. Le difficoltà tecniche con il test FISH includevano l'assenza di materiale diagnostico per la valutazione e segnali deboli della sonda. I campioni, che non erano valutabili, avevano stadio inferiore e punteggio Gleason inferiore.

In questa coorte di uomini con diagnosi di tumore localizzato, la frequenza della fusione di TMPRSS2: ERG era del 15% (17/111). TMPRSS2: i tumori ERG positivi alla fusione avevano maggiori probabilità di avere un punteggio Gleason più elevato ( P bilaterale = 0, 01) (Tabella 1). Per valutare la relazione tra stato di fusione e carcinoma prostatico letale, abbiamo impiegato la regressione cumulativa dell'incidenza (Kalbfleisch e Prentice, 2002) per tenere conto delle cause concorrenti della morte nel tempo. Abbiamo osservato un'associazione statisticamente significativa tra la presenza di TMPRSS2: fusione ERG e metastasi o morte specifica per malattia (Figura 1c) con un rapporto di incidenza cumulativo (CIR) di 2, 7 ( P <0, 01, intervallo di confidenza al 95% (CI) = 1, 3 -5.8). Quando si aggiustava per il punteggio Gleason, il CIR era 1, 8 ( P = 0, 2 e IC 95% = 0, 6-5, 3). Basato sull'omogeneità del TMPRSS2: fusione ERG nelle cellule di un dato tumore (Perner et al., 2006) e sua presenza nel carcinoma prostatico invasivo e circa il 20% del carcinoma prostatico di grado elevato con fusione genica associata (Perner et al., in corso di stampa), riteniamo che questo sia un evento iniziale. Per valutare l'associazione della sovraespressione di ERG con la fusione genica in questa coorte basata sulla popolazione, abbiamo eseguito QPCR per il gene ERG (ERG f: esone 5–6, CGCAGAGTTATCGTGCCAGCAGAT ed ERG r: esone 5–6, CCATATTCTTTCACCGCCCACTCC) come descritto di recente (Tomlins et al., 2005), in un sottoinsieme di 28 casi. Un'espressione di ERG elevata è stata osservata nel 12/12 TMPRSS2: tumori della prostata da fusione ERG in contrasto con 2/16 tumori della prostata senza TMPRSS2: fusione ERG ( P <0, 0005) (Figura 2). Pertanto, l'86% dei casi di carcinoma prostatico con elevata espressione di ERG in questo sottogruppo presentava TMPRSS2: fusione di ERG . Questo risultato conferma la nostra precedente scoperta in cui 19 dei 20 casi di carcinoma prostatico con sovraespressione di ERG avevano mostrato TMPRSS2: riarrangiamento ERG mediante sequenziamento (Tomlins et al., 2005).

Tabella a grandezza naturale

Image

L'espressione ERG è associata a TMPRSS2: stato di fusione ERG . L'espressione della trascrizione del cDNA di ERG è stata determinata usando QRT-PCR in tempo reale per 28 campioni di carcinoma della prostata prelevati dalla vigile coorte in attesa. Tutti e 12 i TMPRSS2: i tumori della prostata a fusione genica ERG hanno dimostrato espressione di ERG. Solo 2 su 16 TMPRSS2: i casi ERG negativi alla fusione hanno dimostrato espressione ERG. Pertanto l'86% dei casi con sovraespressione di ERG ospita anche la fusione del gene TMPRSS2: ERG . Il rapporto tra espressione di trascrizione ERG / gliceraldeide-3-fosfato deidrogenasi (GAPDH) è stato normalizzato alla linea cellulare Meg-01, che esprimeva debolmente ERG (asse y ). Se nessun prodotto ERG PCR è stato identificato dopo 40 cicli, questo è stato considerato negativo (cioè, ERG / GAPDH = 0).

Immagine a dimensione intera

È interessante notare che un'elevata espressione di ERG è stata vista come protettiva nell'unico altro studio sul cancro alla prostata (Petrovics et al., 2005) che ha esaminato ERG, in cui alti livelli di trascrizione ERG erano associati a una minore incidenza di insufficienza biochimica dell'antigene prostatico specifico (PSA). I risultati di Petrovics devono essere esaminati con cautela, poiché l'insuccesso biochimico è un punto finale surrogato mediocre per punti finali clinicamente significativi, tra cui la ricaduta clinica e la morte, come dimostrato da tre recenti studi. Porter et al. (2006) hanno osservato un fallimento biochimico del PSA del 45, 5% in una serie di prostatectomie radicali, ma la morte specifica per carcinoma prostatico si è verificata solo nel 18, 5% della popolazione con un tempo di follow-up fino a 25 anni. Carver et al., 2006 hanno riferito di una popolazione di uomini con carcinoma prostatico T3 sottoposto a prostatectomia radicale, solo il 36% con insufficienza biochimica del PSA presentava una progressione della malattia. Ward et al., 2003 hanno scoperto che in una popolazione di 3897 pazienti con prostatectomia radicale, solo l'8, 3% degli uomini con insufficienza biochimica del PSA è morto di cancro alla prostata. Pertanto, l'insufficienza del PSA è associata alla morte specifica del carcinoma prostatico, ma la maggior parte degli uomini con insufficienza biochimica del PSA morirà per altre cause. Pertanto, l'associazione tra TMPRSS2: stato di fusione ERG e morte per cancro alla prostata è una relazione molto più affidabile.

La coorte di Watchful Waiting di Örebro rappresenta una popolazione naïf di trattamento proveniente da un bacino idrografico rigorosamente definito per 190 000 abitanti che vivono a Örebro. La frequenza di TMPRSS2: fusione ERG in questa vigile popolazione in attesa è inferiore al 55% (16/29) riportato da Tomlins et al. (2005) e 78% (14/18) riportati da Soller et al. (2006) e il 49, 2% (58/118) riportato da Perner et al. (2006). Queste differenze potrebbero essere spiegate dalla percentuale più bassa di casi di alto grado in questa vigile coorte di attesa rispetto agli altri studi non basati sulla popolazione.

In sintesi, questi dati suggeriscono che la fusione TMPRSS2: ERG può contribuire a un fenotipo più aggressivo del carcinoma prostatico e forse spiegare in parte il carcinoma prostatico di grado più elevato. Inoltre, questo studio supporta il ruolo critico di ERG come oncogene nel carcinoma della prostata.

Informazione supplementare

Documenti Word

  1. 1.

    Dati supplementari

    Informazioni supplementari accompagnano l'articolo sul sito Web di Oncogene (//www.nature.com/onc).